You are a mad scientist. You have figured out a way to replace one part of the respiratory and circulatory systems. You believe by doing this one thing you can create an army of physically unbeatable warriors and conquer the world. (Remember you are MAD!) a - What part would you replace to accomplish this? b - What would you replace it with? c - Explain your thinking on how doing this would help create these powerful warriors.

Answer:These six pollutants are carbon monoxide, lead, nitrogen oxides, ground-level ozone, particle pollution (often referred to as particulate matter), and sulfur oxides.

Answer:

It contains many genes.

Explanation:

Genes are region in DNA that code for stuff. Thus, one strand of DNA has many genes.

Answer:

d) food

Explanation:

Food gives animals their strength. When an animal eats, its body goes through a process called digestion to break down the food's minerals. This makes it possible for nutrients like carbs, proteins, and fats to get into the bloodstream. Animals need this energy to do things like grow, reproduce, and move.

Food gives animals the vitamins, minerals, and energy they need to do what they do, grow, have babies, and stay healthy as a whole. A healthy diet also makes sure that animals get the vitamins and minerals they need to keep their immune systems strong and keep them alive.

The food chain and food web may be found at this link: https://brainly.com/question/16065961.

Answer:

1.AATACGGGGGCGTAACCACTA

mRNA: UUAUGCCCCCGCAUUGGUGAU

Amino Acid: Leu, Cys, Pro, Arg, Ile, Gly, Asp

2.GCTAGTACGTGCACATTAGAA

mRNA: CGAUCAUGCACGUGUAAUCUU

Amino Acid: Arg, Ser, Cys, Thr, Cys, Ans, Leu

Explanation:

I abbriviated the amino acids.  If you ever need to find the mRNA of DNA, apply the smae rules to the mRNA but A goes with U.  

RNA : Replace Thymine (T) with Uracil (U)

To find amino acids:  Use an mRNA codon

Answer:

It would die ,without the needed skills and characteristics to live in a specific environment

Answer:

Explanation:

cheek cells

The hip abductor muscles isometrically contract to prevent unnecessary thigh movement in the frontal plane during a squat.

During a squat, the hip abductor muscles isometrically contract to prevent unnecessary thigh movement in the frontal plane.

for such more questions on frontal plane.

https://brainly.com/question/14825378

#SPJ11

Answer:

When Frederick Griffith discovered two strains of Streptococci in 1923, the bacteriologists were intrigued by the differences between them: the S (smooth) strain, which produces colonies that are smooth and shiny on a lab plate; the R (rough) strain, which lacks a polysaccharide coat and produces colonies that are rough and irregular on a lab plate.

Explanation:

As an island splits in two and the halves drift apart, a population of local birds is divided and The construction of a road divides a rabbit population are allopatric.

Allopatric: What is it?

The term "speciation" is used to describe how new species are formed during the process of evolution.

Allopatric speciation is also known as geographic or vicariant speciation.

In a group of mice, some mice consume only fruit, while others only consume seeds, Some female African cichlids will only mate with blue-colored males,

While others will only mate with red-colored males and the sympatric. Some beetles in a community will only pair up at night,

While others will only pair up during the day are all sympatric .

To Learn more About Allopatric Refer To:

brainly.com/question/12387377

#SPJ1

Answer:

Exercising

Explanation:

Exercising acts as a factor which cause a faster rate of blood flow.

Activator proteins are DNA-binding proteins that bind to specific DNA sequences adjacent to the gene that they regulate. These sequences are referred to as activator binding sites.Activator proteins are transcription factors that regulate gene expression by binding to specific DNA sequences and recruiting RNA polymerase to the gene promoter.

These DNA sequences are usually located upstream of the transcription start site and are referred to as enhancers or activator binding sites. Activator binding sites are characterized by a consensus sequence that binds to the DNA-binding domain of the activator protein. Once the activator protein is bound to the enhancer or activator binding site, it can interact with other proteins in the transcriptional machinery to enhance or activate gene expression. Overall, activator proteins play an essential role in regulating gene expression by binding to specific DNA sequences and recruiting RNA polymerase to the promoter region of the target gene.

To learn more about DNA visit;

https://brainly.com/question/30006059

#SPJ11

Answer:

Nothing would happen.

Why:

Nothing would happen because the bulb would need to be connected to both ends of the battery in order for it to turn on or the current could not be completed.

Answer:

1800

Explanation:

60*30=1800

Hope this helps!

Answer:

B

Explanation:

B is the correct answer. A molecule is made up of at least two atoms, but not nessessarily with the same element. A compound is made up of two or more atoms AND there are at least two different elements. Therefore, a molecule can be a compound if it has two different elements, or a chemical substance if it has only one type of element.

* By the way, elements are from the Periodic Table

Or you can use the process of elimination to rule out A, C, and D, if it's too confusing. C is not true because not all elements exists as molecules. They exist as atoms. D is not true because when two atoms combine, they always form a molecule, not a compound.  A is not true because a compound IS a molecule, while a molecule CAN BE a compound.

There are two categories of free nerve-ending thermal receptors: cold receptors and warm receptors.

All across the body, including the skin and internal organs, free nerve terminals serve as sensory receptors. Our capacity to perceive and react to various stimuli, such as changes in temperature, pressure, and pain, depends heavily on these receptors. Thermal receptors are free nerve-endings that respond to thermal stimuli and are in charge of sensing temperature changes. Free nerve-ending thermal receptors may be divided into two categories: cold receptors and warm receptors. These receptors react to temperature changes by communicating electrical impulses to the brain, which are subsequently translated into feelings of heat or cold.

When the temperature of the skin or other tissue falls below a certain threshold, usually between 30 and 35 degrees Celsius, cold receptors become active. The skin and mucous membranes have the highest concentration of these receptors, and they are particularly sensitive to variations in skin surface temperature. The brain interprets electrical impulses that are sent by active cold receptors as feelings of coldness or cooling.

On the other hand, warm receptors become active when skin or other tissues reach a particular temperature, usually between 40 and 45 °C.  Warm receptors deliver electrical impulses to the brain that are translated into feelings of warmth or heat when they are triggered.

Our life and well-being depend on our capacity to detect temperature changes because it enables us to keep a constant body temperature throughout a variety of situations. As they are connected to other sensory receptors that react to pressure, vibration, and other tactile stimuli, thermal receptors also play a significant part in our sensation of touch. We are able to experience the rich tapestry of sensations that make up our daily experience of the world because of the intricate interplay between these many types of sensory receptors.

Therefore, the two categories of free nerve-ending thermal receptors are cold and warm receptors which are very essential for bodily functions.

Learn more about sensory receptors at: https://brainly.com/question/29712459

#SPJ11

Answer:

D

Explanation:

3 centimetres per litre

Answer:

no idea as picture is not shown clearly

Answer:

Once absorbed into the lymphatic system, the interstitial fluid becomes known as lymph and travels through the lymphatic vessels to the subclavian veins where it re-enters the blood circulation and maintains blood volume.

Explanation:

Answer:

C. observation, question, hypothesis, prediction, experiment/observation, conclusion

Explanation:

Almond milk comes from plants, and neither lactose nor cholesterol are found in it. People who are lactose intolerant can drink this kind of milk because it typically has few saturated fats.

The laboratory process for measuring the protein content of 2% almond  lactose differs slightly from that of 2% normal fresh milk due to the absence of lactose, cholesterol, and saturated fats. Barfoed's test and Selivanoff's test are typically used to analyze the sugar content of conventional cow milk,  cholesterol but a third test—the Benedict test—is needed for almond milk because it has far fewer sugars than regular milk. Since almond milk contains more calcium and sodium than regular cow's milk, a typical titration method should be carried out.

Learn more about  cholesterol here

https://brainly.com/question/27756235

#SPJ4

Hiiii!

The difference between transgenic and knockout animals is simple, but they are very similar.

Transgenic animals should have 1 UNKNOWN piece of DNA(active)

Knockout animals have inactive piece(s) of DNA, I'm pretty sure

To find TB,B, we use the inverse of Ic,B to obtain the change of base matrix from B to C. We then multiply this matrix with Tc,C and Ic,B to get TB,B as a 2x2 matrix with entries 2, 2, -3, -3.

To find the coordinate matrix TB,B of T with respect to B, we need to use the change of base matrix from B to C, which is the inverse of the change of base matrix from C to B. That is:

Ib, C = (Ic, B)⁽⁻¹⁾

First, we find the inverse of Ic, B:

| 0 -2 |⁻¹ | 3 3 |

| 3 3 | = |-1 2 |

Now, we can use this matrix to find the coordinate matrix TB,B as follows:

TB,B = Ib, C * Tc,C * Ic, B

TB,B = (Ic, B)⁽⁻¹⁾ * Tc,C * Ic, B

TB,B = | -1 2 | * | -1 0 | * | 0 -2 |

| 3 3 | | 2 1 | | 3 3 |

TB,B = | 2 2 |

|-3 -3 |

Therefore, the coordinate matrix TB,B of T with respect to B is:

TB,B = | 2 2 |

|-3 -3 |

Learn more about matrix here: brainly.com/question/28180105

#SPJ4

Commonly the place where a population lives is described was a habitat, forming a biological community, however there is not an option with that term, but between the present terms the one that is closer to a term for the area where a population lives is D. Geographic Distribution, since all the other alternatives are related to different factors of ecological studies.

The importance of stem cells is that they are differentiated and can become daughter cells.

Stem cells have the potential to serve as the foundation of treatments for a wide range of illnesses due to their capacity to develop into almost any type of cell in the body. Standardized methods for stem cell cultivation and differentiation will be created as research advances.

In the body, stem cells have the capacity to differentiate into a wide variety of cell types. They act as the body's system for repairs. Adult stem cells and embryonic stem cells are the two primary categories of stem cells.

Therefore, one can say that daughter cells are created when stem cells divide properly in the body or a lab to create more cells. These daughter cells either differentiate into more stem cells or into cells with a more focused purpose.

Learn more about daughter cells from

https://brainly.com/question/14666929
#SPJ1

Coping strategies are an important tool to help individuals navigate difficult situations and to improve an unhealthy relationship.

Coping strategies involve using problem-solving skills, communication skills, and other positive behaviors to resolve conflict and improve the relationship. For example, communication skills such as active listening, expressing empathy, and expressing needs can help to create a safe space for both parties to share their feelings and needs.

This can help to create a trusting and secure relationship by allowing all parties to feel heard and respected. Additionally, problem-solving skills can help to find solutions to issues, rather than just focusing on the problems.

By breaking down the issues into smaller parts and working through them, both parties can gain a better understanding of each other and the conflict. With these coping strategies, individuals can better understand their own emotions and the emotions of their partner, leading to a healthier and more fulfilling relationship.

Know more about Coping strategies here

https://brainly.com/question/20621579#

#SPJ11

Answer:

the first answer is cells and the second is energy

Explanation:

I took the quiz

All organisms are made up of cells and the energy is the ability to do work and perform all the functions necessary to live.

The cell is the functional unit of all living things made up of a cell membrane, the cytoplasm that contains the components of the cell and the genetic material.

When the cell needs to perform a function to live, it breaks the ATP molecules to release the energy contained in their bonds, being the energy that fuels the chemical reactions necessary to perform all the functions necessary to live.

Therefore, we can conclude that all organisms are made up of cells and the energy is the ability to do work and perform all the functions necessary to live.

Learn more about cells and the energy here: https://brainly.com/question/10566214

Answer: the answer is C, Carnivores

Explanation: it says that spiders eat other insects, which makes them a Carnivores. I also have the same quiz in Illuminate but that's not really important, I just thought that it was cool that we go to the same school :)

is the B is correct the letter (B)

Water will move to the side with more solutes (from right to left) therefore, option (B) is correct.

Diffusion is the movement of particles or molecules from an area of higher concentration to an area of lower concentration. It is a natural process that occurs in liquids, gases, and solids and is driven by the tendency of particles to move from areas of higher concentration to lower concentration in order to achieve equilibrium.

Diffusion is a vital process in living organisms, as it helps to distribute nutrients, oxygen, and other substances throughout the body. It also plays a role in the movement of gases in and out of cells and in the regulation of temperature and pH within cells.

Learn more about diffusion, here:

https://brainly.com/question/24746577

#SPJ2

The ape-like feature of proconsul is b) elbow joints that were capable of locking.

The monkey-like capabilities included: skinny teeth enamel, mild construct with slim chest and quick forelimbs, curved metacarpals, lengthy bendy lower back and a quadrupedal lifestyle. The ape-like traits included: no tail, massive lateral supracondylar region, and a bigger mind relative to frame size. The ape-like tendencies included: no tail, huge lateral supracondylar region, and a larger thoughts relative to border size.

The famous fossil hominoid Proconsul from the Early Miocene of Kenya become a non-specialized arboreal quadruped with robust pollical/hallucial assisted greedy capability.

Therefore, option c is correct.

To learn more about traits check the link below:

https://brainly.com/question/9089686

#SPJ4

Answer:

The ANSWER is C.

Explanation:

Quizlet

Natural resources in the environment are allocated responsibly according to demand and economic strength. Option C

Resource allocation is division of goods for the use of production within the economy. It must be determined whether the production, as well as the process of production, creates more benefits that costs for the producers, consumers, and society as a whole.

Read more on Resources Allocation:

https://brainly.com/question/10541288

#SPJ2