Why should we be cautious when interpreting many of the reports linking certain aspects of brain anatomy to behavior?

Answers

Answer 1

Examining the impact of brain injury is one method of studying brain-behavior interactions. If someone experiences a loss as a result of brain trauma, that area contributes to that behaviour in some manner.

Which portion of the brain is responsible for movement and instinctive reflexes?

The brain stem is in charge of reflexes and automatic functions (such as heart rate and blood pressure), as well as limb motions and visceral processes (digestion, urination). The cerebellum combines location and movement information from the vestibular system and uses it to control limb movements.

Neuroimaging enables functional investigations of the brain and its connections. The fundamental goal of neurorehabilitation for a stroke patient is to have other brain areas take over the functions of the parts that have been damaged.

learn more about brain anatomy refer

https://brainly.com/question/28147511

#SPJ4


Related Questions

Out of the three physical states: ice, liquid water and vapor, why do you think water exists as a liquid ​the most o​ n our planet?

Answers

It would be definitely be water

I think it is because of the temperature of the earth.

If ice was the most common physical state on our earth it would be because of how cold it would be. Other way around with vapor.

what term is used to describe an explosive, disorderly discharge of cortical neurons?

Answers

The term used to describe an explosive, disorderly discharge of cortical neurons is "seizure."

A seizure is a sudden and abnormal electrical activity in the brain that can cause a wide range of symptoms, such as convulsions, loss of consciousness, sensory disturbances, and behavioral changes.

Seizures can be caused by various factors, such as brain injury, infections, genetic conditions, or neurological disorders like epilepsy. The exact mechanisms behind seizures are not fully understood, but they are thought to be related to imbalances in the brain's electrical and chemical signaling.

Seizures are typically classified based on their location in the brain and the type of symptoms they produce. For instance, partial seizures occur in a specific region of the brain and can cause localized symptoms like muscle twitching or sensory disturbances, while generalized seizures involve the entire brain and can cause loss of consciousness and convulsions.

Click the below link, to learn more about Seizure:

https://brainly.com/question/30115967

#SPJ11

If someone could help me figure out how to do these sorts of problems I would really appriciate it​

If someone could help me figure out how to do these sorts of problems I would really appriciate it

Answers

Answer:

The possible genotypes are:

\(I^AI^B, I^AX^H, I^AX^h, I^BI^B, I^BX^H, I^BX^h, X^HX^H, X^HX^h\)

good luck, i hope this helps :)

If someone could help me figure out how to do these sorts of problems I would really appriciate it

This is a genetic question:
The Bionomial is a more complex calculation used when you have multiple events AND multiple outcomes. Use the following P (s of A, t of B) = ( N! ) ps qt
S! T!
BTW= s + t = n and p+q = 1

Answers

The formula for the binomial distribution is:

P(s of A, t of B) = (N! / (S! * T!)) * (p^s) * (q^t)

Where:

N is the total number of trialsS is the number of successes in the trialsT is the number of failures in the trialsp is the probability of success in each trialq is the probability of failure in each trial

The binomial distribution is a useful tool for calculating the probability of a specific number of successes in a set of trials. It is commonly used in fields such as genetics, where it can be used to calculate the probability of a specific genetic outcome occurring in a population.

Here to learn more about the binomial distribution at the link

https://brainly.com/question/29163389

#SPJ11

Why have the tortoises evolved on the Galapagos Islands?

Answers

Answer:

The splitting of context es and better envirnment for them more adaptfull  

Explanation:

The bacterium Brucella abortus imports and uses the unusual sugar erythritol. The concentration of erythritol within the B. abortus cell is 10mM, but the external erythritol concentration is much lower at 0.20mM. What is the energy requirement ( ΔG inward in kcal/mol ) for the inward transport of erythritol at 37

C under these conditions? Constants: R=1.987cal/mol−K;F=23,062cal/mole−volt −2.42kcal/mol; exergonic reaction +30.79kcal/mol; endergonic reaction +2.41kcal/mol; exergonic reaction +2.41kcal/mol; endergonic reaction +29.61 kcal/mol; endergonic reaction

Answers

The energy requirement (ΔG inward in kcal/mol) for the inward transport of erythritol at 37C under these conditions is -2.42 kcal/mol.

The energy requirement (ΔG inward in kcal/mol) for the inward transport of erythritol at 37C can be calculated as follows: ΔG°′ = −(RTlnKeq)Since ΔG = ΔG°′ + RTlnQ,

where Q is the reaction quotient, therefore,ΔG = −(RTlnKeq) + RTlnQ= RTln(Q/Keq)Here, ΔG is the free energy change and R is the gas constant, T is the temperature in Kelvin, Keq is the equilibrium constant and Q is the reaction quotient.The equilibrium constant Keq for the transport of erythritol from outside the cell to the inside of the Brucella abortus cell is equal to the concentration of erythritol inside the cell divided by the concentration of erythritol outside the cell.

Keq = [Erythritol]in / [Erythritol]outThe equation for ΔG, isΔG = RTln(Q/Keq)

Where R = 1.987 cal/mol.K, T = 37 °C + 273 = 310 K, Keq = [10 mM] / [0.20 mM] = 50.ΔG = -2.303RTlog(Q/Keq)ΔG = -2.303 x 1.987 x 310 log (50)ΔG = - 2.42 kcal/mol Therefore, the energy requirement (ΔG inward in kcal/mol) for the inward transport of erythritol at 37C under these conditions is -2.42 kcal/mol.

To know more about energy visit:

https://brainly.com/question/1932868

#SPJ11

Why do you think sundews need to capture insects?
A. The sundew is unable to make enough food.
B. The insects provide water to the plant.
C. The sundew is protecting itself from insects.
D. The insects provide nutrients that are missing from the soil.

Answers

Answer:

d

Explanation:

Some plants eat insects because they don't get enough of nitrogen from the soil and to regulate the amount of nitrogen they eat insects. These plants are called Insectivorus plants.

Answer:I think sundew is a carnivorous plant isn't it?Then it must be its nature to capture insect and eat them.

Explanation:I don't say you must have to mark my ans as brainliest but my friend if it has helped you a lot then don't forget to thank me...

What is you were an astronaut and interplanetary explorer and you discovered “something” on another planet,like Mars that reproduced by itself, grew in size, took in food, responded to you or other stimuli, but did not seem to be made of cells or possess DNA or RNA. would you consider it to be living or nonliving?

Answers

Answer:

I would consider it to be nonliving

Explanation:

The characteristics of life demarcates a living thing from a nonliving thing. These characteristics include the ability to move, ability to respire, ability to reproduce, ability to undergo nutrition (take in food), ability to respond to external stimuli, ability to grow by increasing in size and more importantly must be made up of at least a single cell. Cell is the fundamental and basic unit of all living things.

This object found in Mars may be able to perform every other characteristics of a living thing e.g reproduction, irritability, growth, nutrition etc but to be considered as a living thing, it must consist of at least one CELL, which in turn must contain either a DNA or RNA molecule that carries information about its genetic content.

Hence, according to the universal CELL THEORY that states that "All living things contains one or more cells", this something found on Mars is not considered living.

what is found in the body cells but not sex cells

Answers

Answer:

Sex Cells have 1 set of chromosomes while Body Cells have 2 sets of chromosomes  

Meiosis reduces chromosome number so that sex cells (eggs and sperm) have a half set of chromosomes–one homolog of each pair. This is the haploid number.

Explanation:

Do all solutions have to be liquid

Answers

Answer:

no, they could be powder, it mainly consists of the ingredients

Explanation:

Answer:

No not all of them do

Explanation:

Analyze the effects of DNA mutations
on the
of an organism.

Answers

Answer:

DNA mutations or Chromosomal mutations are also called chromosomal aberrations, chromosomal abnormality, or chromosomal disorders, all indicating a possible alteration in the morphology and structure of the chromosome.

DNA mutations lead to abnormalities in the function of the cell and organism, as chromosomal or DNA mutations can result in abnormal gene numbers or positions.

These are known to cause different genetic diseases that can be hereditary and are transferred from one generation to another.

These mutations, however, do not always affect the functioning of the cell as some mutations might affect regions of chromosomes that do not make up the genetic makeup of the organism.

Even though gene mutations are usually more severe than chromosomal mutations, some chromosomal mutations might result in gene mutations.

original DNA: TACTTTAATCCCAAATTTACT

DNA: TACTTTAATCCCAAGTTTACT
mRNA: ?
amino acid: ?
what type of mutation is this: ?​

Answers

Answer:

substitution mutation

Explanation:

The original DNA sequence is: TACTTTAATCCCAAATTTACT

The mutated DNA sequence is: TACTTTAATCCCAAGTTTACT

The mRNA transcribed from the mutated DNA sequence is: AUGAAAUUAGGGUUAAUUAGA

The amino acid sequence encoded by the mRNA is: Met-Lys-Ser-Trp-Lys-Lys-Ser

This is an example of a substitution mutation, in which a single nucleotide in the DNA sequence is changed. In this case, the original DNA sequence contains the nucleotide A at position 13, while the mutated sequence contains the nucleotide G at the same position. This change causes a different mRNA sequence to be transcribed and a different amino acid to be encoded. Substitution mutations can have a variety of effects on gene function, depending on the location and nature of the mutation. Some substitution mutations may have no effect, while others may cause the protein encoded by the gene to function improperly or not at all.

What kind of adaptations did plants have to make to live on land?

Answers

Answer:

a water-repellent cuticle, sto.mata to regulate water evaporation, specialized cells to provide rigid support against gravity, specialized structures to collect sunlight, alternation of haploid and diploid generations, se..xual organs and many more

Explanation:

Hope this helps much!! From Awelch :^)

If you only wanted to increase the particle motion of a gas without increasing any of it's other properties, which would the most correct situation?

a
Keep the gas at a constant pressure and keep the temperature constant, but increase the volume of the gas
b
Keep the gas in a fixed container at constant pressure and increase the temperature
c
Keep the gas in a fixed container at constant pressure and decrease the temperature
d
Keep the gas at a constant volume and keep the temperature constant, but decrease the pressure of the gas

Answers

If we keep the gas in a fixed container at constant pressure and increase the temperature which leads to the increase in its motion.

With an increase in temperature, the particles move faster because they gain kinetic energy which them power to move more faster. If the temperature is decreases again than the motion of gas particles slower down.

The particles of gas again moves slowly due to loss of kinetic energy so we can conclude that increasing the temperature causes in the increase of motion of the gas particles if pressure is constant.

Learn more: https://brainly.com/question/24814070

Help ASAP!!!! 20 points.

Help ASAP!!!! 20 points.

Answers

Answer:

5= mRNA is “messenger” RNA. mRNA is synthesized in the nucleus using the nucleotide sequence of DNA as a template. This process requires nucleotide triphosphates as substrates and is catalyzed by the enzyme RNA polymerase II. The process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

The water cycle gets its energy from the ___?

Answers

Answer:

the sun

Explanation:

answer pls! due today and don’t know what the answer is

answer pls! due today and dont know what the answer is

Answers

Answer:

it's the second one

frameshift mutation.

the ability of an ecosystem to return to its equilibrium state after an environmental disturbance is called

Answers

The ability of an ecosystem to return to its equilibrium state after an environmental disturbance is called resilience.

Resilience is a key characteristic of healthy ecosystems, as it allows them to recover from disturbances such as natural disasters, climate change, or human activities. A resilient ecosystem is able to maintain its structure and function, and adapt to changing conditions over time. This can be achieved through various mechanisms, such as the presence of diverse species and functional groups, the existence of feedback loops and self-regulation processes, or the availability of resources and habitats for organisms to recover and grow. Building resilience in ecosystems is therefore critical for maintaining their biodiversity, productivity, and services, and for ensuring their long-term sustainability in the face of global environmental challenges.

To know more about ecosystem visit :

https://brainly.com/question/30376964

#SPJ11

Difference between eukaryotic cells and prokaryotic cells.​

Answers

I hope this helps you

........

Difference between eukaryotic cells and prokaryotic cells.

Answer:

eukaryotic cells are those which have a membrane-bound nucleus that contains genetic material, as well as organelles that are also membrane-bound. Whereas, prokaryotes are cells that don’t have a nucleus or membrane-encased organelles.

Explanation:

hope it will help you !

what will happen if there is no gravitational pull in earth​

Answers

A lack of gravity would eventually take its toll on our very planet, writes Masters. "Earth itself would most likely break apart into chunks and float off into space." ... Without the force of gravity to hold it together, the intense pressures at its core would cause it to burst open in a titanic explosion.

In the absence of gravity, whatever thing we threw would fly away indefinitely.

What is gravity?

the force that pulls a body towards the direction of the earth's center or any other mass-containing physical body. In other words, it is a characteristic of things, of matter. All matter is drawn to all other matter, to put it simply. The stronger the attraction between objects, the more matter there is, and the closer together the items are.

It is the gravitational attraction of all the material in the Sun, pulling it firmly together, that enables nuclear fusion to occur and provides us with heat and light. It was initially responsible for the development of the Solar System. Nevertheless, despite its pervasiveness, gravity is one of the Universe's most enigmatic forces. All objects with mass, including our Earth, really bend and curve spacetime, which is what causes gravity to pull you toward the ground. What you experience as gravity is that curvature.

Hence, We couldn't survive without gravity. It produces the force that keeps the Earth in orbit around the band that keeps us on the surface of the planet.

Learn more about gravity, here:

https://brainly.com/question/14874038

#SPJ2

Materials needed for “how does the color of light affect plant growth” experiment

Answers

Different color lights such as blue, red, plants, black paper, etc are required for an experiment to understand the affect of light on plant growth.

How does light affect plant growth?

Light intensity influences plant growth and development as it is responsible for the manufacture of plant food (Carbohydrate) that is photosynthesis, stem length, leaf color and flowering in response to light. Generally, plants grown in low light tend to be spindly with light green leaves or small leaves. A similar plant grown in very bright light tends to be shorter, better branches, and have larger, dark green leaves with more number.

Different color lights (different wavelengths) help plants to achieve different goals as well such as growth and flowering. Blue light, for example, helps a plant to encourage vegetative leaf growth. Whereas red light, when combined with blue, allows plants to flower more.

Learn more about Plant growth here:

https://brainly.com/question/9323511

#SPJ1

in an alligator, the integumentary system includes scales, fat, and claws. an organ such as the skin is composed of

Answers

in an alligator, the integumentary system includes scales, fat, and claws. an organ like

What is an alligator's body like?

Its color is greenish, almost brown, with a yellowish belly, a broad and flat snout, and it can measure up to 3 meters in length. Alligators are nocturnal animals and during the day they form groups to sunbathe. It feeds on fish, birds and mammals.

With this information, we can conclude that Alligators are large reptiles and members of the order Crocodylia. The two existing species of alligators and the many worldwide species of crocodiles are closely related, and people often confuse one with the other. An alligator is distinguished by its wide, rounded snout and black color.

Learn more about Alligators in  brainly.com/question/154092

#SPJ1


Photosynthesis consists of which two primary steps

A. Light Reactions and Citric Acid Cycle

B. Light reactions and Calvin Cycle

C. Dark Reactions and Citric acid Cycle

D. Dark Reactions and Calvin Cycle

Photosynthesis consists of which two primary stepsA. Light Reactions and Citric Acid CycleB. Light reactions

Answers

Answer:

B.

Explanation:

B. Light reactions and Calvin Cycle

Which evidence of the giant impact theory suggests that Earth and the moon may have once been in the same place?

Answers

Answer:

the Apollo rocks came back, they showed that the Earth and the Moon have some remarkable chemical and isotopic similarities, suggesting that they have a linked history

Explanation:

In what stage do stars spend the large majority of their life cycles? Why

Answers

A star will enjoy most of its life in the main sequence phase. At this point nuclear fusion is turning hydrogen into helium. The star is only stable because the light pressure of this energy balances out the star's gravitational collapse.

Whales and hippos are thought to have evolved from a common ancestor around 54 million years ago. Which of the following is also true about these species?

Answers

Answer:

Both whales and hippos have almost no hair on their bodies. They do not have sweat glands.

Explanation:

Regulating the Cell Cvele
READING TOOL Make Connections In the graphic organizer below, fill in each box with headings from this unit to help you understand the concepts.

Regulating the Cell CveleREADING TOOL Make Connections In the graphic organizer below, fill in each box

Answers

A cell cycle is the sequence of events that occur in a cell as it develops and splits. A cell spends the majority of its time in what is known as interphase, where it develops, copies its chromosomes, and prepares for cell division.

What is the cell cycle ?

The cell cycle, also known as the cell-division cycle, is the sequence of events that occurs in a cell that causes it to split into two offspring cells. These events include the reproduction of its DNA and some of its organelles, followed by the split of its cytoplasm, chromosomes, and other components into two daughter cells in a process known as cell division.

The cell cycle in nucleated cells (eukaryotes, which include mammal, plant, fungal, and protist cells) is split into two stages: interphase and the mitotic (M) phase (including mitosis and cytokinesis).

Learn more about cell cycle

https://brainly.com/question/15876101

#SPJ1

Which describes the notation Tt for the trait of plant height?

Answers

Answer: Heterozygous genotype

Explanation: it has two variant forms of a gene that is ‘T’ and ‘t’ which shows dominant and recessive allele respectively.

Answer:

Heterozygous genotype

Explanation:    

if microbe a and microbe b have whole genome similarity of 68%, as determined by dna-dna hybridization, they should be considered the same species.

Answers

if microbe a and microbe b have whole genome similarity of 68%, as determined by dna-dna hybridization, they can not be considered as same species

The gold standard for genomic similarity assessments of pair-wise sets of strains for classification purposes has been DNA-DNA hybridization (DDH) methods. The approach has been extremely important in the last 50 years of prokaryote categorization. To determine how closely two genomes are related, a variety of methods have been developed. These methods largely rely on determining the degree of hybrid reassociation or the temperature stability of the hybrids. (DNA-DNA hybridization) DDH has received a lot of flak for being time-consuming, unreliable, and incapable of creating cumulative databases. These factors, along with recent advancements in genome sequencing, argue for the replacement of DDH methods with alternative strategies based on genome-to-genome sequence comparisons.

To learn more about DNA-DNA hybridization:

https://brainly.com/question/13259262

#SPJ4

Which factor influences the early detection of a childhood disease by a physician?

A. Whether the child is in school
B. The child's diet
C. How close the doctor's office is
D. The number of friends the child has

Answers

The factor that influences the early detection of a childhood disease by a physician is the child's diet  (Option B).

Why may the child's diet influence the emergence of diseases?

The child's diet may directly influence the emergence of diseases because unhealthy food habits are associated with an increase in cardiovascular problems, hypertension, etc.

Therefore, with this data, we can see that the child's diet influence the emergence of diseases because a child who has unhealthy food habit are prone to suffer certain diseases such as obesity, hypertension, cardiovascular issues, etc.

Learn more about the child's diet and diseases here:

https://brainly.com/question/11591917

#SPJ1

Other Questions
If the reaction quotient (Q) is smaller than the equilibrium constant (K) for a reaction then which way will the reaction proceed? a. The reaction is at equilibrium and the reaction will proceed at equal rates in the reverse and forward direction. b. The reaction will proceed to the right (products side) c. The reaction equation is required to answer this question d. The reaction will proceed to the left( reactants side) Why are Index fossils a good tool for determining the age of a rock layer? Because index fossils are of organisms that existed for a long period of time. Finding them in a rock layer, will determine the life span of similar animals found today. Because index fossils are of organisms that existed for a long period of time. When finding them in a rock layer, you can be certain that the rock layer was formed in that long-time frame. Because index fossils are of organisms that existed for a long period of time. Finding them in a rock layer, will bring you good luck. Because index fossils are of organisms that existed for a short period of time. When finding them in a rock layer, you can be certain that the rock layer was formed in that small-time frame. Write an algebraic expression to represent the new y-coordinate after a translation of four yards south given any initial y-coordinate, y. please helpThe linear model represents the height, f(x), of a water balloon thrown off the roof of a building over time, x, measured in seconds: Goldfinger inc. is a company exploiting a gold mine. Its share is currently traded at $900. Suppose thatthe yield curve for risk-free rates is flat at r =1% per year.a) What is the no-arbitrage 6-month forward price for one share of Goldfinger?b) Today you enter a short position in a 6-month forward contract on 500 shares of Goldfinger at theforward price calculated in part a):il) How much do you pay today to enter the short position?(I) Is this trade an arbitrage strategy? Justify your answer in no more than 3 lines. can anyone help me with this medical anatomy question? :) A(n) is a complex molecule located within each cell. a nucleic acid b atom c enzyme d gamete The ____________ fibers that crisscross the cytoplasm of the cell are collectively called the cytoskeleton. Why is it important to have optimum binder content in asphalt concrete? What would happen if a less-than-optimum binder content is used? What would happen if more than the optimum value is used? What is the typical range of binder content in asphalt concrete? a(n) is an intended beneficiary of a contract who receives the benefits of the contract as a gift. a. incidental beneficiary b. assignor c. donee beneficiary What 3 words summarizes Judaism Drag each letter based on whether or not the corresponding representation answer key demonstrates a reflection over the x-axis, y-axis or neither a parent of a child with acute poststreptococcal glomerulonephritis (apscn) asks how streptococcal infection caused the child to have a kidney problem. what is the nurse's best response? 100 POINTS AND BRAINLIEST Index fossils give us clues to_______________? According to the Value Proposition of Dataiku, by providing the capabilities for managing operational risks and ensuring legal and regulatory compliance, Dataiku helps organizations to: a.Unify diverse teams working on AI b.Streamline the path to production c.Centralize Al initiatives from data to impact d.Govern Al projects at scale If you have 10,000 grams of a substance that decays with a half-life of 14 days, then how much will you have after 70 days? evaluate the national committee for quality assurances (ncqa) impact on health information systems scholarly which price control is used for valuing materials that are purchased, such as raw materials and trading goods? a. Describe the three processes under process designationb. Identify the management, core, and support process types in asupermarket. Suppose you have a string with linear mass density u=4.5 g/m, with two fixed ends 1.0 m apart. What is the velocity of a wave on the string if the tension of the string is supplied by a hanging mass of 250 g? 2) For the previous question, what are the three lwoest frequencies that you could observe in a standing wave? If sin t = 6/11, and t is in Quadrant II, find cos t, csc t, sec t, tan t, and cot t.