Why does everyone keep saying I should call Uraraka “red cheeks” instead of “pink cheeks” (=_=)

Answer:244866.088

Explanation:

Answer:

Answer:244866.088

Explanation:

Answer:

Physical

Explanation:

Water is the chemical form of 2 hydrogen and 1 oxygen (H2O)

It is still H2O, as nothing made it chance that formula.

The acid having the yellow anion is a weak acid.

The weak acid is the acid that does not dissociate completely in solution. Strong acids are known to dissociate completely in solution. Hence, their cations and anions do not occur together in solution.

Weak acids acids do not dissociate in solution hence, we can still spot the cations connected to their anions in solution. Hence, the acid having the yellow anion is a weak acid.

Learn more: https://brainly.com/question/8743052

To calculate the number of equivalents of substance Y used in the reaction, we need to consider the stoichiometry of the balanced equation. From this, the number of equivalents of substance Y used in the reaction is equal to the number of moles of substance Y used, which is 1229.25 mmol.

The stoichiometric equation for the reaction is given as 2X → 2Z. This means that 2 moles of substance X react to produce 2 moles of substance Z.

From the given information, we have:

Moles of substance X = 17 mmol

Moles of substance Z = 68 mmol

Since the stoichiometric ratio between X and Z is 2:2, we can conclude that 17 mmol of substance X will produce 17 mmol of substance Z.

Now, using the stoichiometric ratio, we can determine the moles of substance Y required to react with 17 mmol of substance X:

2 moles of X → 144.5 mmol of Y

17 mmol of X → (144.5 mmol of Y × 17 mmol of X) / 2 moles of X

Calculating this expression:

(144.5 mmol × 17 mmol) / 2 = 1229.25 mmol

Therefore, the number of equivalents of substance Y used in the reaction is equal to the number of moles of substance Y used, which is 1229.25 mmol.

Learn more about the number of equivalents here:

https://brainly.com/question/29941956

#SPJ 4

The statement which best describes a pure substance is that it has constant physical properties which is therefore denoted as option B.

This is referred to as a single kind of matter that cannot be separated into other kinds of matter by any physical means.

This type of sample of matter has both definite and constant composition and distinct chemical properties and is referred to as being homogeneous in nature with no form of impurities which is therefore the reason why it was chosen a the correct choice.

Read more about Pure substance here https://brainly.com/question/18452279

#SPJ1

The increasing order of basicity, putting least basic nitrogen atom first are as follow:

N2 < N1 < N3.

The basicity of the atom is inversely proportional to the resonance.

Resonance is also termed as mesomerism, is defined as a way of telling the bonding in certain polyatomic ions or molecules by the combination of varies contributing structures into the resonance hybrid in the valence bond theory.

Since, in N2 due to the presence of lone pair of electron and it not even donate these lone pair of electron. On the other hand they take part in resonance, therefore the basicity of the N2 is least.

In N3 the lone pair of electron is present and it able to donate these lone pair of electron to the sp3 hybridization, therefore the basicity of the N3 is more than N2.

Thus, we concluded that increasing order of basicity, putting least basic nitrogen atom first are N2 < N1 < N3.

learn more about basicity:

https://brainly.com/question/15344589

#SPJ4

For a redox reaction to be spontaneous, the overall ΔEº' is: (a.) positive and transfer of electrons occurs from a molecule with lower affinity to one with higher affinity.

For a redox reaction to be spontaneous, the overall ΔEº' (standard reduction potential) must be positive. The standard reduction potential measures the tendency of a species to gain electrons and undergo reduction.

In a redox reaction, electrons are transferred from one molecule or species to another. The molecule or species that gains electrons is reduced, while the molecule or species that loses electrons is oxidized.

In a spontaneous redox reaction, the species with a lower affinity for electrons (lower reduction potential) will donate electrons, and the species with a higher affinity for electrons (higher reduction potential) will accept those electrons. This transfer of electrons occurs from a molecule with lower affinity to one with higher affinity.

The positive value of ΔEº' indicates that the overall reaction is thermodynamically favorable, meaning it will proceed spontaneously in the direction of electron transfer from the molecule with lower affinity to the one with higher affinity.

Based on this information, the correct answer is:

a. positive and transfer of electrons occurs from a molecule with lower affinity to one with higher affinity.

Learn more about redox reaction at: https://brainly.com/question/459488

#SPJ11

A gas can become a solid by either reducing the temperature or increasing the pressure. The process by which a substance changes its state from one to another can be explained using the kinetic molecular theory.

1. Adding energy to a solid generally affects the motion of the particles. This is because the amount of energy added will determine how fast or slow the particles move. By increasing the amount of energy in a solid, the particles move faster and can therefore break away from their fixed positions. If the temperature continues to rise, then the energy added may be sufficient to break the intermolecular bonds that hold the particles together. At this point, the solid will change into a liquid. If more energy is added to the liquid, then the intermolecular bonds will break, and the liquid will become a gas. The three states of matter - solid, liquid and gas - can be differentiated based on the motion of their particles.

2. A gas at room temperature like oxygen can become a solid by reducing the temperature and/or increasing the pressure. This is because when the temperature is lowered, the particles lose kinetic energy and slow down. This causes the particles to move closer together, decreasing the distance between them. If the temperature is lowered to the point where the kinetic energy of the particles is no longer enough to overcome the attractive forces between them, then the gas will become a liquid or a solid.

To know more about molecular theory visit:-

https://brainly.com/question/14352403

#SPJ11

Answer:

decrease temperature of the oxygen

Explanation:

Answer: I believe it it decrease temp of oxygen

Explanation:

Answer:

Mendeleev predicted the existence of a yet-undiscovered element he named ecka-aluminium (because of its proximity to aluminium in the periodic table).

The purpose of using O3 (ozone), H2 (hydrogen), KMnO4 (potassium permanganate), NaOH (sodium hydroxide), NaH (sodium hydride), and NaBH4 (sodium borohydride) as reagents in various chemical reactions varies depending on the specific reaction being carried out.

O3 is commonly used as an oxidizing agent and is particularly useful for breaking down double bonds in organic compounds. H2 is often used as a reducing agent, meaning it is used to add electrons to a molecule in order to reduce its oxidation state.

KMnO4 is a strong oxidizing agent and is used in a variety of reactions to transfer oxygen atoms to other molecules.
NaOH is a strong base and is used in reactions where deprotonation is required.
NaH is a strong base and is often used as a source of H- ions in various reactions.
NaBH4 is a reducing agent commonly used to reduce carbonyl groups (such as aldehydes and ketones) to alcohols.

To know more about  chemical reactions  visit:-

https://brainly.com/question/29762834

#SPJ11

Answer:

For all atoms with no charge, the number of electrons is equal to the number of protons. The mass number, 40, is the sum of the protons and the neutrons. To find the number of neutrons, subtract the number of protons from the mass number.

Explanation:

Answer:

Letter C. Subtract the atomic number from the atomic mass

When \(NH_4NO_3\) dissolves in water, the enthalpy of the system decreases, and the entropy of the system increases. The increase in entropy is the driving force of the process, causing the solute to dissolve in the solvent. Option A is the correct answer.

When \(NH_4NO_3\) dissolves in water, it undergoes an endothermic process in which heat is absorbed from the surroundings, causing the temperature of the solution to decrease. This suggests that the dissolution process is driven by an increase in the system's entropy, rather than by a decrease in enthalpy.

The enthalpy change of the system can be determined by measuring the heat of the solution, which is the amount of heat absorbed or released when a solute dissolves in a solvent. In the case of \(NH_4NO_3\), the heat of the solution is positive, indicating an endothermic process in which heat is absorbed. This means that the enthalpy of the system decreases when \(NH_4NO_3\) dissolves in water.

The entropy change of the system can be determined by calculating the difference in the entropy of the solution and the sum of the entropies of the separate components (the solute and the solvent) before mixing. In the case of \(NH_4NO_3\) dissolving in water, the increase in the disorder of the system is driven by the release of ammonium ions and nitrate ions into the solvent. The disorder of the system increases because the ions become more dispersed and move around freely in the solution. This increase in entropy is the driving force of the process.

To learn more about enthalpy

https://brainly.com/question/16720480

#SPJ4

Complete question:

Which of the following describes the enthalpy and entropy changes of the system when \(NH_4NO_3\) dissolves in water, and which change drives the process?

a) Enthalpy decreases and entropy increases; entropy change drives the process

b) Enthalpy increases and entropy decreases; enthalpy change drives the process

c) Enthalpy decreases and entropy decreases; enthalpy change drives the process

d) Enthalpy increases and entropy increases; entropy change drives the process

b. The entropy of the system must increase in any spontaneous process. c. A reaction that is spontaneous in one direction will be nonspontaneous in the reverse direction under the same conditions. e. For any spontaneous process, K will increase as temperature (T) increases.

a. The statement is true. Entropy change for an isothermal process depends on both the absolute temperature and the amount of heat reversibly transferred.
b. The statement is true. The second law of thermodynamics states that the entropy of the system must increase in any spontaneous process.
c. The statement is true. A reaction that is spontaneous in one direction may not be spontaneous in the reverse direction under the same conditions. The direction of a reaction depends on the Gibbs free energy change (ΔG) and if ΔG is negative, the reaction is spontaneous in that direction.
d. The statement is false. The rate of a process is not related to its spontaneity. Spontaneous processes can be slow or fast.
e. The statement is true. For any spontaneous process, K (equilibrium constant) will increase as temperature (T) increases.

Learn more about   Entropy  here:

https://brainly.com/question/13135498

#SPJ4

The chemical formula of hydroiodic acid is HI.

Chemical formula is as used in chemistry is a notation indicating the number of atoms of each element present in a compound. It shows the type and number atoms of an element present in a compound.

For example, the molecular or chemical formula for ethane is C₂H₆.This shows that ethane contains 2 carbon atoms and 6 hydrogen atoms.

Hydroiodic acid is a compound made up of two elements namely;

Therefore, the chemical formula for hydroiodic acid is HI.

Learn more about chemical formula at: https://brainly.com/question/29031056

#SPJ1

Answer:

Which nuclear force holds the nucleus together against the mutual repulsion of the protons in every nucleus larger than Hydrogen’s?

Explanation:

Hi Arri, this is my question, if you cannot answer that it is fine. I hope you are doing well though :) best of luck to you when you are gone. Stay safe, well wishes

In the given Bronsted-Lowry reaction between \(HSO^-^4\) and HF, the acid and base can be identified. The acid is \(HSO^-^4\), while the base is HF.

In this reaction, \(HSO^-^4\) acts as the acid because it donates a proton (\(H^+\)) to the base, HF. The \(HSO^-^4\) ion, also known as the bisulfate ion, has a hydrogen ion (\(H^+\)) that can be transferred to the base, making it an acid. On the other hand, HF acts as the base as it accepts the proton from \(HSO^-^4\). The fluoride ion (\(F^-\)) in HF has a lone pair of electrons that can accept the donated proton, resulting in the formation of the acid-base conjugate pair.

The reaction can be represented as follows:

\(HSO^-^4 + HF\) ⇌ \(H_2SO_4 + F^-\)

In this reaction, \(H_2SO_4\) is the resulting acid formed when \(HSO^-^4\) donates its proton to HF, which becomes the resulting base in the form of fluoride ion (\(F^-\)). The reaction is reversible, indicating that the acid and base can interconvert depending on the reaction conditions.

Learn more about Bronsted-Lowry reaction here:

https://brainly.com/question/31659921

#SPJ11

The binding of the amino acid in aminoacyl-tRNA involves the formation of an ester bond.  Option b

Aminoacyl-tRNA is a complex molecule that plays a crucial role in protein synthesis. It consists of a tRNA molecule covalently linked to an amino acid. The amino acid is attached to the 3' end of the tRNA molecule through an ester bond.

An ester bond is formed between the carboxyl group (-COOH) of the amino acid and the hydroxyl group (-OH) of the ribose sugar at the 3' end of the tRNA molecule. This ester bond is also referred to as an ester linkage. The formation of the ester bond is catalyzed by the enzyme aminoacyl-tRNA synthetase.

The ester bond in aminoacyl-tRNA is essential for protein synthesis. During translation, the aminoacyl-tRNA molecule carries the specific amino acid to the ribosome, where it is incorporated into the growing polypeptide chain. The ester bond is later hydrolyzed, releasing the amino acid for further use in protein synthesis.

In summary, the binding of the amino acid in aminoacyl-tRNA involves the formation of an ester bond between the carboxyl group of the amino acid and the hydroxyl group of the ribose sugar in the tRNA molecule.

Option b

For more such question on amino acid visit:

https://brainly.com/question/30265108

#SPJ8

The covalent phosphodiester bonds of DNA are hydrolyzed by restriction enzymes, leaving either "sticky/cohesive" ends or "blunt" ends.

By incubating the target DNA molecule with restriction enzymes, which detect and bind certain DNA sequences and cleave at specified nucleotides either inside or outside of the recognition sequence, restriction digestion is carried out.

An isolated bacterial protein known as a restriction enzyme cleaves DNA at sequence-specific locations to create DNA fragments with a known sequence at either end. Restrictions enzymes are crucial for numerous laboratory processes, including recombinant DNA technology and genetic engineering.

At the particular restriction site, DNA bonds between the 3′ OH of one nucleotide and the 5′ phosphate of the following one are cleaved by restriction enzymes.

In order to prevent the plasmid vector from ligating with itself and to verify that the inserted gene is oriented correctly, two separate restriction enzyme sites might be used.

A) #1 5′ - CGTGATCTCGATTCGCTAGTAACGTT - 3′

         3′ - GCACTAGAGCTAAGCGATCATTGCAA - 5′

    #2 5′ - TCATGAATTCCTGGAATCAGCAAATGCA - 3′

         3′ - AGTACTTAAGGACCTTAGTCGTTTACGT - 5′

B) Recognition sites:

#1 5′ - GAATTC - 3′

    3′ - CTTAAG - 5′

#2 5′ - GAATTC - 3′

    3′ - CTTAAG - 5′

C) Cleavage sites:

#1 5′ - G    AATTC - 3′

    3′ - CTTAA    G - 5′

#2 5′ - G    AATTC - 3′

    3′ - CTTAA    G - 5′

The correct and complete question is in the image.

Learn more about Restriction enzymes here:

https://brainly.com/question/13944056

#SPJ4

The atmospheric pressure at your home, when converted to kPa, is approximately 102.4 kPa.

A barometer measures atmospheric pressure, and in your case, it reads 768.2 mm of Hg (mercury). To convert this value to kilopascals (kPa), we'll use the conversion factor: 1 mm of Hg equals approximately 0.133322 kPa.

Now, simply multiply the given barometer reading by the conversion factor:

768.2 mm of Hg × 0.133322 kPa/mm of Hg = 102.4 kPa

This conversion is essential for comparing pressure readings in different units or using them in various calculations where a specific unit, like kPa, is required. Atmospheric pressure can influence weather conditions, and having a standardized unit like kPa allows for easier comparisons and analysis of weather data.

You can learn more about atmospheric pressure at: brainly.com/question/30166820

#SPJ11

Answer:

positive charge

Explanation:

protons are the positive chargers of any chemical reaction unlike neutron which are just the neutral part

Answer:

Positive charge

Explanation:

Electrons are Negative charge

The common way is the use of active voice when writing an abstract because passive voice make an indirect writing of the action and indication of a person in the action.

Abstract is the first phase of a thesis or a publication in a journal. It briefly summarizes about what we are going tp communicate through that paper or thesis what are the major methods used and also tell about the major findings and conclusions.

Thus, abstract must be concise but sharp and clear to the point about each step in the experiment of the scientific investigation whatever. It must be following the same tense of action that is in past or present. All sentence should follow the same tense.

Now, it is commonly better to avoid passive voice to write the actions and if possible write it in active voice. Direct indication of the person in charge and the action is good to read.

Find more on abstract writing:

https://brainly.com/question/14121465

#SPJ1

If the mass of the sun is 1x, at least one planet will fall into the habitable zone if I place a planet in orbits 2, 6, and 75, and all planets will orbit the sun successfully.

If the mass of the sun is 2x, at least one planet will fall into the habitable zone if I place a planet in orbits 84 , 1, and 5, and all planets will orbit the sun successfully.

If the mass of the sun is 3x, at least one planet will fall into the habitable zone if I place a planet in orbits 672 and 7, and all planets will orbit the sun successfully.

When Earth is closer to the sun, there will be hotter climate. A little movement that takes one closer to the sun could lead to a huge impact.

Due to the fact that there is warming that can make the glaciers to melt, there is an increase in the sea levels and flooding occurs in a lot of areas of the planet and when there is no land to absorb some of the sun's heat, the temperatures on Earth would tend to rise more.

Learn more about sun  form

https://brainly.com/question/15837114

Answer:

It's a combination reaction

\( \underline{ \underline{ \texttt{Combination reaction }}}\)

What is combination reaction?

a reaction in which two reactants combine to form one product.

Why is it combination reation?

As you can see phosphorus and oxygen combined to form Phosphorus trioxide.

The products obtained from the redox reaction provided are \(CoCl_{2}\) and Sn, and a balanced equation for the redox reaction is: \(SnCl_{2} (aq) + Co (s)\) → \(CoCl_{2} (aq) + Sn (s)\) .

If the number of each type of atom in the reaction is the same on both the reactant and product sides, then a chemical reaction is said to be balanced. In a balanced chemical equation, the mass and the charge on the atoms are both equal. The given incomplete reaction can be completed as follows to obtain the products:

\(SnCl_{2} (aq) + Co (s)\) → \(CoCl_{2} (aq) + Sn (s)\)

The products obtained are in the same phase as that of the reactants. SnCl2 reacts as a reducing agent and converts Co (cobalt) into CoCl2 in aqueous phase and separates itself as a solid. If Co is reduced, Sn is oxidized too as Sn attains an oxidation state of 0. This is why, this is a redox reaction.

To know more about a redox reaction, refer:

https://brainly.com/question/21851295

#SPJ4

The statement NADH and FADH2 donates electrons to the electron transport chain at the same point is true.

In this step  NADH and FADH2, donates electrons to the electron transport chain at the same time. Hence, with the above details we can conclude that the given statement is true.

Learn more about Aerobic cellular respiration on

https://brainly.com/question/25424208

#SPJ1

The theoretical yield of salicylic acid according to the balanced overall equation is found to be 1.6g.

The maximum mass of a product that can be produced in a chemical process is known as the theoretical yield. The balanced chemical equation can be used to calculate it. the limiting reactant's mass and relative formula mass. The percent yield is 100% if the theoretical and actual yields are equal. Because the real yield is frequently lower than the theoretical value, percent yield is typically lower than 100%.

Molar mass methyl salicylate = 152 g/mole

moles methyl salicylate present = 1.77 x 1/152= 0.0116 moles

Theoretical yield of salicylic acid = 0.0116 x 138g/mol = 1.6g of salicylic acid

Learn more about salicylic acid here:

brainly.com/question/14635153

#SPJ4

Answer:

c = 0.043 j/ g. °C

Explanation:

Given data:

Amount of sample = 500 g

Initial temperature = 55.0°C

Final temperature = 25.0°C

Heat required released = 640 J

Specific heat capacity of sample = ?

Solution:

Formula:

Q = m.c. ΔT

Q = amount of heat absorbed or released

m = mass of given substance

c = specific heat capacity of substance

ΔT = change in temperature

ΔT = 25°C - 55°C

ΔT = -30°C

by putting values,

-640 J = 500 g × c × -30 °C

c  = 640 J / 500 g× 30 °C

c = 640 J /15000 g. °C

c = 0.043 j/ g. °C