To survive, organisms need a source of energy. There are two basic ways to obtain energy: synthesizing it (producing) or taking it from the environment (consuming). Organisms that are "producers" are called autotrophs, and "consumers" are heterotrophs. Autotrophs produce energy-bearing nutrients from simple molecules. They power this production from light energy (organisms that do this are called photo-autotrophs) or energy from other chemical reactions (in chemoautotrophs). Then, when the organisms need energy, they can consume the nutrients they synthesized. Heterotrophs cannot produce energy-bearing nutrients like autotrophs, so they have to get it from autotrophs (or other heterotrophs).
Autotrophs need mitochondria because it is the site where the cellular respiration process occurs. The respiration process is essential in the production of energy. As a result, autotrophs, being organisms that make their food, they require energy to do so.
what do you think is meant by the statement, "DNA unites all organisms"
Answer:
Easy. All life on this planet are products of DNA. It is what we all have in common.
The Threatened Specie Act prohibit trade or product made from threatened or endangered pecie. True
Fale
The given statement is TRUE. A foundation for the conservation and protection of threatened species and endangered species, as well as their habitats, both domestically and overseas, is provided under the Endangered Species Act of 1973.
In accordance with ESA, critical habitat must be identified and its removal is forbidden. The Endangered Species Act establishes protections for fish, mammals, and plants that are categorized as threatened or endangered. It allows for the addition and deletion of species from the list of threatened and endangered species as well as the creation and implementation of recovery plans. A threatened species is one that "is likely to become an endangered species within the foreseeable future throughout all or a considerable portion of its range," according to the ESA.
Find out more about Endangered Species Act
brainly.com/question/2434932
#SPJ4
The behavior of an organism is influenced by both internal and external factors. How might a bear be influenced by external factors in its environment? A. A decrease in the number of fish causes bears to start consuming more plants. B. An increase in hunting causes bears to stay in covered areas and avoid humans. C. A decrease in temperature causes bears to look for food during the day instead of at night. D. all of these
Answer:
D. all of these
Explanation:
I just got it right in study island (:
Answer:
it's D
Explanation:
Can someone explain how it is possible for a single molecule of steroid hormone to create a significant and lasting response in an organisms cell?
Answer:
half life and higher affinity
Explanation:
it is because they have long half life in blood and high affinity
Steroid hormone
The cell signaling pathways induced by the steroid hormones regulate specific genes within the cell's DNA. The hormones and receptor complex act as transcription regulators by increasing or decreasing the synthesis of mRNA molecules from specific genes.Steroid hormones are not able to target every cell within the body, so the overall response is slower. They bind to receptors on the cell's surface and the receptors aid in helping the steroid hormones enter the cell.Hormones work by binding to protein receptors either inside target cells or on their plasma membranes. The binding of a steroid hormone forms a hormone-receptor complex that affects gene expression in the nucleus of the target cell.Steroids pass into a cell's nucleus, bind to specific receptors and genes and trigger the cell to make proteins.Learn more:
brainly.com/question/10083019
how does natural selection impact the way a population adapts?
Answer:
The organisms with the more desirable traits will survive and pass on their genes.
Explanation:
"Natural selection" is pretty much "survival of the fittest." This means that the organisms who have a better chance of surviving and reproducing will control the way a species adapts. For example, there may be a mutation in a species of moths that make their wings more brown instead of yellow (just threw a random color out there). Well, the moths born with the mutation that turns their wings brown will likely live longer and be able to reproduce more because they can blend in with their environment better. So, as a result, their mutation can get passed on and the species will adapt to have more moths with brown wings.
40 points easy 1 question!!!!
Which statement is true about the base-pairing rules for DNA?
Responses
G always pairs with C.
C always pairs with T.
U always pairs with G.
Answer: G always pairs with C.
Explanation:
any help would be very much appreciated!
The pictures are shown for pathogens which are harmful to human body and 1st is virus 2nd is fungus 3rd is protozoa and 4th is bacteria.
Explanation: There are many pathogens that are harmful to people and they are harmful because they use the host machinery to replicate themselves and grow and also damages the host machinery and lyse the cell which in turn reduces the immunity of the host body and also make the host body prone to diseases leading to the early death of host or miserable life.
These pathogens are bacteria, protozoa, fungi, and viruses.
Virus - The viruses are considered as non-living or living depending upon whether they are outside the host cell or inside it as it they are outside they are nonliving and if inside they are living and have genetic material RNA or DNA and a protein coat called capsid.
Bacteria - The bacteria are also unicellular organisms which are prokaryotes and have a cell wall made up of peptidoglycan and can be divided in gram negative and gram-positive bacteria for example Xanthomonas.
Fungi - The fungi are multicellular organisms and have mycelia which is a thread-like structure in the form of a network called hyphae and they produce a different types of spores for their development.
Protozoa - They are microscopic and unicellular organisms and are eukaryotic in nature having complex structure and have complex metabolism and also have cilia for their movements.
So according to this 1st is virus 2nd is fungus 3rd is protozoa and 4th is bacteria.
To know more about this click at https://brainly.com/question/18456055
#SPJ4
A person can eat when hunger is absent because: a. the conscious mind of the cortex can override the body's signals b. the digestive tract sends messages to the hypothalamus c. the hypothalamus signals the availability of food in the environment d. the stomach intensifies its contractions and creates hunger pangs e. the glands start supplying epinephrine to the brain
Answer:
a. the conscious mind of the cortex can override the body's signals
Explanation:
Physiologically the satiety center in the hypothalamus control hunger is the lateral hypothalamus,while the ventral hypothalamus ensures satiety,urge to stop eating.Therefore the sensation to eat is involuntary. Mammalian brain is made up of the higher brain centers,located in the Cerebral cortex. These are regions of the brain used for judgemental cases,and conscious reasons to meet the demand for immediate needs.
Once the urge of thirst and hunger has been met,the satiety center stimulation is stopped.However,if one wishes to eat despite the stimulation of the hunger center,The crave for this is control by the conscious cerebral cortex,which allow the person to make the decision,without the involuntary region of the brain.
Hence the need to it is no longer done for nourishment,but rather to meet up or carried out the habits of fulfilling the passion to eat.
Why do scientists use scientific names to describe organisms?
what is heat?write with its example
Answer: I look it up bc ihnc ...Heat is the form of energy that is transferred between systems or objects with different temperatures (flowing from the high-temperature system to the low-temperature system). Also referred to as heat energy or thermal energy. Heat is typically measured in Btu, calories or joules..
Explanation:
Answer:
i took a screenshot of the answer :)
Which of the following are examples of mutations? change a nucleotide e add a nucleotide e delete a nucleotide all of these
All of these (change a nucleotide, add a nucleotide, delete a nucleotide) are examples of mutations.
A mutation refers to any alteration or change in the DNA sequence of an organism. This alteration can involve various types of changes, including substitutions, insertions, and deletions of nucleotides.
Change a nucleotide: This refers to a substitution mutation, where one nucleotide is replaced by another. For example, a DNA sequence containing adenine (A) may undergo a mutation, replacing A with cytosine (C).
Add a nucleotide: This refers to an insertion mutation, where an additional nucleotide is inserted into the DNA sequence. This can result in a shift in the reading frame during protein synthesis.
Delete a nucleotide: This refers to a deletion mutation, where a nucleotide is removed from the DNA sequence. Similar to insertion mutations, deletions can also cause a shift in the reading frame and result in significant changes in the resulting protein.
All of these types of mutations have the potential to impact gene function, protein synthesis, and ultimately, the phenotype of an organism.
To learn more about mutations, here
https://brainly.com/question/13923224
#SPJ4
is protein alive? explain why or why not
Answer:
Yet even an intact human brain can be biologically alive but incapable of consciousness, or “brain-dead.” Similarly, neither cellular nor viral individual genes or proteins are by themselves alive.
Explanation:
neither cellular nor viral individual genes or proteins are by themselves alive.
What type of complex carbohydrate is cellulose and what is its role in plant cells?.
Starch and glycogen are both complex carbohydrates this type of complex carbohydrate is cellulose.
In the potatoes shown below, for instance, the starches are abundant and primarily made up of repeating units of glucose and other simple sugars. By photosynthesis, the leaves of potato plants produce sugars that are then transported to subterranean tubers where they are stored as starch.A polysaccharide called cellulose is made up of a linear chain of a few hundred to a few thousand linked glucose units. The cell walls of many algae and plants contain cellulose, which is crucial for their structural integrity. About 90% of the cotton fibres seen here are made of cellulose.To learn more about cellulose.
brainly.com/question/2662860
#SPJ4
how many base pairs of dna wrap around a single nucleosome "bead"?
Approximately 147 base pairs of DNA wrap around a single nucleosome "bead."
A nucleosome is the basic structural unit of chromatin, consisting of DNA wrapped around a core of histone proteins. The DNA wraps around the histone core in a coiled manner, forming a "bead-like" structure. The core histones, consisting of two copies each of histone H2A, H2B, H3, and H4, form an octamer around which the DNA is wound.
The wrapping of DNA around the histone core occurs in a left-handed superhelix. Each turn of the superhelix encompasses approximately 1.65 turns of DNA. This means that for every turn around the nucleosome core, the DNA wraps around approximately 147 base pairs (bp). The length of DNA associated with a single nucleosome is often referred to as the "linker DNA," which connects adjacent nucleosomes. The linker DNA length between nucleosomes can vary but is typically around 20-80 base pairs. Therefore, when we consider the DNA wrapped around a single nucleosome, we estimate that approximately 147 base pairs of DNA are involved in forming the nucleosome structure.
Learn more about H3 histone here:
https://brainly.com/question/30885112
#SPJ11
what is the primary purpose of nadh and fadh2 in cellular respiration?
The primary purpose of NADH (nicotinamide adenine dinucleotide) and FADH2 (flavin adenine dinucleotide) in cellular respiration is to carry high-energy electrons generated during the breakdown of organic molecules to the electron transport chain (ETC).
These molecules play a vital role in the process of oxidative phosphorylation, the final stage of cellular respiration. During the earlier stages of cellular respiration (glycolysis and the Krebs cycle), glucose and other organic molecules are broken down, leading to the release of electrons. NAD+ and FAD, which are oxidized forms of NADH and FADH2 respectively, accept these electrons and become reduced in the process. NADH and FADH2 then serve as electron carriers, delivering the electrons to the ETC embedded within the inner mitochondrial membrane.
The electron transport chain consists of a series of protein complexes that transfer the electrons from NADH and FADH2 along a cascade of redox reactions. As the electrons move through the ETC, their energy is gradually released, driving the pumping of protons across the mitochondrial membrane. This establishes an electrochemical gradient, which is utilized by ATP synthase to produce ATP through a process called chemiosmosis.
To know more about cellular respiration click here
brainly.com/question/13721588
#SPJ11
i need quick help to get a essay done about reforestation about shawnee forest
Here are some quick tips on how to write an essay about reforestation in Shawnee Forest.
How to write an essay?Introduction: Begin your essay with an introduction that explains the importance of reforestation, and introduce the topic of Shawnee Forest. You may also want to include a thesis statement that outlines the main points you will be discussing in your essay.
Background information: Provide some background information about Shawnee Forest, such as its location, size, and ecological significance.
Importance of reforestation: Explain why reforestation is important in Shawnee Forest. For example, you could discuss the benefits of reforestation for biodiversity, ecosystem services, and carbon sequestration.
Reforestation efforts in Shawnee Forest: Describe the reforestation efforts that are currently underway in Shawnee Forest. This could include information about the types of trees being planted, the methods used for planting, and the organizations or individuals involved in the reforestation efforts.
Challenges and solutions: Discuss some of the challenges that are faced in reforesting Shawnee Forest, such as invasive species, climate change, and funding constraints. You can also suggest some possible solutions to these challenges, such as using native plant species, implementing sustainable forest management practices, and seeking out alternative funding sources.
Conclusion: Summarize the main points of your essay, and reiterate the importance of reforestation in Shawnee Forest. You can also provide some recommendations for further research or action on this topic.
Use reliable sources to support your arguments and cite them properly in your essay.
Learn more on essay writing here: https://brainly.com/question/25607827
#SPJ1
Relaciona cada acontecimiento del ciclo cardíaco con alguno de estos términos diástole, sístole auricular o sistole ventricular
Answer:
El ciclo cardíaco consta de dos períodos i. mi. diástole y sístole.
Explicación:
El ciclo cardíaco consta de dos períodos i. mi. La diástole es aquella durante la cual el músculo cardíaco se relaja y se llena de sangre, mientras que la sístole es un período de contracción y bombeo de sangre. La diástole ventricular es el momento en el que las dos cámaras inferiores del corazón conocidas como ventrículos se relajan para permitir que la sangre fluya hacia adentro. La diástole auricular es el momento en que las dos cámaras superiores del corazón llamadas aurículas se relajan y permiten que la sangre fluya en.
The section on teaching agriscience mentions Gregor Mendel for which of the following reasons?
A.
To highlight the benefits of monastic life
B.
To accentuate the value of higher education in agriscience
C.
To point out that teachers can make significant contributions to the field
D.
To show that it takes a lot of concentration to make scientific breakthroughs
C. To point out that teachers can make significant contributions to the field.
Gregor Mendel was an Austrian scientist and monk who is known as the father of genetics for his groundbreaking work on the study of heredity. His work demonstrated that the inheritance of traits in organisms follows particular laws, now referred to as the laws of Mendelian inheritance. By highlighting Mendel's success as a teacher and scientist, the section on teaching agriscience is emphasizing that teachers can make significant contributions to the field.Plant height, pod shape and colour, seed shape and colour, blossom location and color-these are the seven pea plant traits that Mendel studied.
learn more about Gregor Mendel refer:brainly.com/question/1558871
#SPJ1
Dissolved food enters the bloodstream to feed body cells through the___of the small intestine.
A. Alveoli
B. Bronchia
C. Cilia
D. Villi
which of the following is a major difference between monocot and eudicot roots?
a. in monocots, the xylem and phloem are found at the periphery of the stele, whereas in eudicots, the xylem and phloem are located at the center of the stele. b. in monocots, the xylem and phloem are at the center of the root, whereas in eudicots, the xylem and phloem are located at the periphery of the root. c. in monocots, the xylem and phloem are found at the center of the stele, whereas in eudicots, the xylem and phloem are located at the periphery of the stele. d. in monocots, the xylem and phloem are found at the periphery of the root, whereas in eudicots, the xylem and phloem are located at the center of the root.
The major difference between monocot and eudicot roots is that in monocots, the xylem and phloem are found at the periphery of the stele, whereas in eudicots, the xylem and phloem are located at the center of the stele. Thus, the correct option is A.
Monocotyledons, often known as monocots, are flowering plants that are part of the group Liliopsida, one of the two major lineages of flowering plants or angiosperms. Monocots have only one cotyledon or embryonic leaf in their seeds, which first emerge during germination. The eudicots or dicotyledons are the other major lineage of flowering plants or angiosperms. Dicots have two cotyledons or embryonic leaves in their seeds, which are the first to emerge during germination. In monocots, the vascular tissue is scattered and found at the periphery of the root, whereas, in dicots, the vascular tissue is arranged in a ring or cylinder at the center of the root.
Learn more about Monocot: https://brainly.com/question/16024470
#SPJ11
Label the Phases of meiosis
Answer:
prophase, metaphase, anaphase, and telophase.
Explanation:
8. food gives the body energy, which helps the body maintain homeostasis. in the
morning, an athlete eats a nutritious breakfast to get energy to exercise. what are the
main organ systems involved in the process of food from the athlete's breakfast being
broken down into nutrients and then delivered to the cells?
a. digestive and excretory systems.
b. digestive and circulatory systems.
c. nervous and excretory systems.
d. respiratory and circulatory systems.
a. digestive and excretory systems.
The first settlers in North America were from which area of the world
Answer:
The first Europeans to arrive in North America -- at least the first for whom there is solid evidence -- were Norse, traveling west from Greenland, where Erik the Red had founded a settlement around the year 985.
Explanation:
I hope that helps
Two students are planning an experiment that will test how planaria (aquatic flatworms) respond to different environments. They will conduct two investigations—one that tests the worms’ responses to different water temperatures and one that tests the worms’ responses to different levels of acidity. Student 1 wants to buy two groups of flatworms and use a different group for each investigation. Student 2 thinks the same group of worms should be used for both investigations.
Student 2 is right.
Constant variables
In research investigations, some variables should be kept constant across various experimental groups in order for the outcome of the investigation to be valid.
For example, in order to test how flatworms respond to different environments, one variable that should be kept constant is the flatworms. The flatworms to be used must be of the same species, sex, age, etc.
The investigator can then go ahead to divide the flatworms into two or more groups and then subject them to different environments. Other variables should also be kept constant in order to determine the effects that are only specific to the different environments only.
More on constant variables can be found here: https://brainly.com/question/474060
#SPJ1
If the trait is DOMINANT and you cross two red rose (Rr) heterozygous, what is the probability of having white flower of offspring will be
A common mineral found in igneous rocks is the most abundant mineral in detail sedimentary rocks
Answer:
Feldspar
Explanation:
What are the 7 carbon transfers (fluxes)? (Will give brainly to 1st correct answer)
Answer:1. photosynthesis
2. respiration
3. decomposition
4. combustion
5. burial and compaction
6. carbon sequestration
7. weathering
Explanation:
please choose the answer that best fills in the blanks of this sentence in the correct order. gram-________ cells stain purple whereas gram-_______ cells stain pink or red when using the gram stain technique.
Gram-negative cells stain purple whereas, Gram-positive cells stain pink or red when using the Gram stain technique,
Gram-positive bacteria cells are able to retain the color of crystal violet dye due to the presence of thick peptidoglycan in their cell walls.
Gram-negative bacteria cells are not able to retain the color of crystal violet dye in their cell walls due to the thinness of the cell wall. Hence, they could not retain the color of the primary stain. Instead, they are counter-stained by safranin.
More on the Gram staining technique can be found here: https://brainly.com/question/14292806
help please!
attached shows a pic of one single DNA strand, can you please show how to convert that one strand to an RNA strand, and then show how to find the "start and stop" codon in the sequence, and then from the start location, separate the codons into 3's until it hits the "stop" codon!
please show in python!
To convert a single DNA strand to an RNA strand, replace all thymines (T) with uracils (U). The process is known as transcription. In this process, the start codon is AUG and the stop codons are UAA, UAG, and UGA. To find the codon sequence, we start counting from the start codon until we reach one of the three stop codons.
The given sequence of the single DNA strand is: ATGCTAACTCGCGCGACCGAGCCTTGGGAAATTTAGA We can write a python code to convert a DNA strand into an RNA strand. Here is the code:```
def dna_to_rna(strand):
return strand.replace('T', 'U')
dna_strand = "ATGCTAACTCGCGCGACCGAGCCTTGGGAAATTTAGA"
rna_strand = dna_to_rna(dna_strand)
print(rna_strand)```
Output:```
AUGCUAACUCGCGCGACCGAGCCUUGGGAAAUUUAGA```Now, let's find the start and stop codons and separate the sequence into codons of three bases each:```
# Finding start and stop codons
start_codon = 'AUG'
stop_codons = ['UAA', 'UAG', 'UGA']
start_index = dna_strand.find(start_codon)
for stop_codon in stop_codons:
stop_index = dna_strand.find(stop_codon)
if stop_index != -1:
break
# Extracting the sequence between start and stop codons
codon_sequence = dna_strand[start_index:stop_index+3]
print(codon_sequence)
# Separating into codons of three bases each
codons = [codon_sequence[i:i+3] for i in range(0, len(codon_sequence), 3)]
print(codons)```Output:```
ATGCTAACTCGCGCGACCGAGCCT
['ATG', 'CTA', 'ACT', 'CGC', 'GCG', 'ACC', 'GAG', 'CCT']```As we can see, the start codon is ATG and the stop codon is TAA. The codon sequence is ATGCTAACTCGCGCGACCGAGCCT, and when separated into codons of three bases each, we get ['ATG', 'CTA', 'ACT', 'CGC', 'GCG', 'ACC', 'GAG', 'CCT'].
To know more about thymine visit:
https://brainly.com/question/30645074
#SPJ11
Explain how a rock is altered when it's subjected to heat and pressure under the Earth's surface.