Which statement best describes a property of a compound? A compound is made up of a single atom. B. A compound is made up of many atoms that are all the same type. C. A compound can be separated into two or more elements through physical processes. D. A compound can be separated into two or more elements through a chemical reaction.

Answers

Answer 1

Answer:

D. A compound can be separated into two or more elements through a chemical reaction.

Explanation:

By method of elimination, we are going t obtain the correct  option.

A. A compound is made up of a single atom.

This is wrong because, a compound can contain more than one atom.  An example is H2O

B. A compound is made up of many atoms that are all the same type.

This is wrong because a compound can contain atoms of different elements. An example is H2O. It contains atoms of hydrogen and oxygen.

C. A compound can be separated into two or more elements through physical processes.

This is wrong. H2O being a compound cannot be separated by ordinary physical means.

D. A compound can be separated into two or more elements through a chemical reaction.

This is the correct option.


Related Questions

Find the number of moles of argon in 452g of argon

Answers

Hello there! :)

\(\huge\boxed{\text{11.315 mol}}\)

We can use dimensional analysis to convert from grams to moles. Use the atomic weight of argon to determine the amount of g/mol.

\(452g * \frac{1 mol}{39.948g} = \frac{452}{39.948}mol = 11.315mol\)

Therefore, there are approximately 11.315 moles in 452 grams of argon.

The number of moles that are contained in the given mass of argon is equal to 11.32 moles.

Given the following data:

Mass of argon = 452 grams.

Scientific data:

Molar mass of argon = 39.948 g/mol.

How to calculate the moles of a compound?

In this exercise, you're required to determine the number of moles of argon that are contained in the given sample.

Mathematically, the number of moles contained in a given mass of chemical compound is calculated by this formula:

\(Number \;of \;moles = \frac{mass}{molar\;mass}\)

Substituting the given parameters into the formula, we have;

Number of moles = 452/39.948

Number of moles = 11.32 moles.

Read more on number of moles here: brainly.com/question/3173452

#SPJ2

what is buckminsterfullerene in chemistry​

Answers

Buckminsterfullerene, also known as C60 or buckyball, is a unique and fascinating molecule in the field of chemistry.

It was first discovered in 1985 by a team of scientists led by Richard Smalley, Robert Curl, and Harold Kroto, who were awarded the Nobel Prize in Chemistry in 1996 for their discovery.

Buckminsterfullerene is a carbon allotrope composed of 60 carbon atoms arranged in a hollow sphere resembling a soccer ball. Its name is derived from its resemblance to the geodesic dome designs created by architect Buckminster Fuller.

One of the remarkable aspects of buckminsterfullerene is its symmetrical structure, which confers extraordinary stability. Its structure allows for the distribution of strain throughout the molecule, making it highly resistant to chemical reactions and providing exceptional thermal and mechanical stability.

Buckminsterfullerene exhibits a range of unique properties that have attracted significant scientific interest. It is an excellent electron acceptor and can undergo various chemical reactions due to its high reactivity. Its electronic properties have applications in organic electronics, photovoltaics, and molecular electronics.

Moreover, buckminsterfullerene has shown potential in various fields, including medicine, material science, and nanotechnology. Its hollow structure can encapsulate other atoms or molecules, making it useful for drug delivery systems.

In summary, buckminsterfullerene is a fascinating carbon molecule with a distinctive structure and exceptional properties. Its discovery has opened up new avenues for research and applications in chemistry, physics, materials science, and other interdisciplinary fields.

For more such question on Buckminsterfullerene visit:

https://brainly.com/question/11848129

#SPJ8

If neon gas travels at 402 m/s at a given temperature, estimate the rate of diffusion of butane gas, C4H10 at the same temperature.

If neon gas travels at 402 m/s at a given temperature, estimate the rate of diffusion of butane gas,

Answers

The estimated rate of diffusion of butane gas, C₄H₁₀ is 182.4 m/s.

How to measure rate of diffusion?

The rate of diffusion of a gas is inversely proportional to the square root of its molar mass. The molar mass of neon gas is 20.18 g/mol, and the molar mass of butane gas is 58.12 g/mol. Therefore, the ratio of the rate of diffusion of butane gas to neon gas is:

(√(20.18 g/mol) / √(58.12 g/mol)) = 0.454

So, the rate of diffusion of butane gas is about 0.454 times the rate of diffusion of neon gas at the same temperature.

To estimate the rate of diffusion of butane gas, we can multiply the rate of diffusion of neon gas by this ratio:

(rate of diffusion of butane gas) = 0.454 x 402 m/s = 182.4 m/s

Therefore, at the same temperature, the estimated rate of diffusion of butane gas is about 182.4 m/s.

Learn more on diffusion rate here: https://brainly.com/question/30584823

#SPJ1

Which of the following is not a magnetic material A cobalt B iron C nickel D plastic E steel

Answers

Answer:

D. plastic

\(\tt{ \green{P} \orange{s} \red{y} \blue{x} \pink{c} \purple{h} \green{i} e}\)

How many Protons, Electrons, and Neutrons are there in Oxygen

Answers

Answer:

Name                        Oxygen

Atomic Mass                 15.999 atomic mass units

Number of Protons 8

Number of Neutrons 8

Number of Electrons 8

Explanation:

Based on the percentages of components in Alka-Seltzer and the balanced equation below, determine the limiting reactant assuming 1 gram of Alka-Seltzer. 3NaHCO3(aq)+C6H8O7(aq)\rightarrow3CO2(gas)+Na3C6H5O7(aq)+3H2O(L) A. acetylsalicylic acid (C9H8O4) B. other ingredients C. sodium bicarbonate (NaHCO3) D. citric acid (C6H8O7)

Answers

Alka-Seltzer contains three main components: sodium bicarbonate (NaHCO3), citric acid (C6H8O7), and acetylsalicylic acid (C9H8O4). .

According to the manufacturer, Alka-Seltzer contains about 325 mg of sodium bicarbonate, 1000 mg of citric acid, and 325 mg of acetylsalicylic acid per tablet. Assuming that 1 gram of Alka-Seltzer is equivalent to one tablet, we can calculate the approximate percentage of each component as follows:

- Sodium bicarbonate: (325 mg / 1000 mg) x 100% = 32.5%
- Citric acid: (1000 mg / 1000 mg) x 100% = 100%
- Acetylsalicylic acid: (325 mg / 1000 mg) x 100% = 32.5%

Using these percentages, we can make an educated guess about the limiting reactant. Since there is an equal amount of sodium bicarbonate and acetylsalicylic acid in Alka-Seltzer (both at 32.5%), and since citric acid is present in a larger amount (at 100%), it is possible that citric acid could be the limiting reactant.

However, without more precise information about the percentages of each component in Alka-Seltzer, we cannot determine the limiting reactant with certainty.

It's worth noting that even if we did know the exact percentages of each component in Alka-Seltzer, there could be other factors that affect the limiting reactant, such as the temperature and pressure of the reaction. Additionally, the reaction may not proceed according to the balanced equation in a real-world scenario.

To know more about alka-seltzer : https://brainly.com/question/10684030

#SPJ11

ANSWER PLS ASAP Fireworks are an example of a
amount of energy being

ANSWER PLS ASAP Fireworks are an example of aamount of energy being

Answers

Answer:

large, released

Explanation:

As we know, fireworks contain l o t s of energy, even before the burst of colors release. So i think choice 3 is the answer.

i hope this helps :)

what is the relationship between macromolecules and obesity?

Answers

Answer: Increased oxidative damage to macromolecules leads to obesity

Explanation: If we try to find the relationship between obesity and macromolecules we will get to know that in adults overweight (obesity) is directly associated with increased oxidative damage to macromolecules.

The impulse experienced by a body is equivalent to its change in: a. velocity b. kinetic energy c. momentum. d. None of the above choices are valid. In an isolated system of particles the momentum of the system is conserved regardless of th number of collisions that occur with in the system. a. true b. false uouo sea s a. true b. false . In an elastic collision the kinetic energy of the eellision before and after the collision will no change

Answers

The impulse experienced by a body is equivalent to its change in momentum. Therefore, the valid answer for the given question is option C.

The impulse experienced by an object can be defined as the change in momentum of the object that occurs when an unbalanced force acts on it.In an isolated system of particles, the momentum of the system is conserved regardless of the number of collisions that occur within the system. Hence, the valid answer for this question is option A, true.In an elastic collision, the kinetic energy of the collision before and after the collision will not change.

Therefore, the valid answer for this question is option A, true. In an elastic collision, both the momentum and kinetic energy of the colliding particles are conserved. The total kinetic energy of the colliding particles before the collision will be equal to the total kinetic energy of the colliding particles after the collision.

Learn more about momentum: https://brainly.com/question/1042017

#SPJ11

in a circuit, the switch
A) opens and closes the circuit
B) starts and stops the electrons

Answers

What happens when the switch in an electronic circuit is closed and opened?
Ad by SolarSolution
Paying over $100 for electricity?
Get a free solar panel installation quote with latest incentives and find out how much you could save!
Learn More
2 Answers
Profile photo for William Rose
William Rose
, Electrical Engineer, Mechanic
Answered 1 year ago · Author has 479 answers and 2.2M answer views
Assuming you do mean electronic and not electrical circuits, then the answer is, most of the failures. Powering up and down electronics stresses most components more than leaving them running all the time. First there is temperature stresses as a cold component begins to warm up. Then there are the voltage and current spikes and surges created as capacitors charge up, inductors build their fields, etc. And its not just the components but the stray capacitance and inductance as well.

Basically, when you turn on a device and it doesn’t work, chances are it failed the moment you turned it on (or the moment you last turned it off). They rarely fail while they are running. An old adage in electronics is, the longer a device operates, the longer it will operate.

I always plug in my power supplies for my phone, laptop, etc., before plugging it into the device so the power supply can stabilize without a load on it. Then I plug it into the device. Then I turn on the device. The idea is to minimize the spikes and surges.

BTW, its the same with incandescent light bulbs. A cold filament is rapidly heated which is a thermal stress. Then there is a mechanical stress caused by the current rushing through the coiled filament which creates a mechanical torque on the filament. That’s why you usually (not always) see a bulb fail when you first switch it on

find the average speed of a person who swims 105 m in 70 s

Answers

Answer:

1.5 m/s

Explanation:

105 / 70 = 1.5

Find the volume of a locker that is 30cm long, 40cm wide, and 200 cm high.

Answers

Answer:

V= L × W × H so the answer is 240,000

25.0 ml of 0.212 m naoh is neutralized by 13.6 ml of an hcl solution. the molarity of the hcl solution is . group of answer choices 0.115 m 0.212 m 0.137 m 0.390 m 0.500 m

Answers

The molarity of the HCl solution is approximately 0.390 M.

To find the molarity of the HCl solution, you can use the formula:

Molarity of acid(M2) x Volume of acid(V2) = Molarity of base(M1) x Volume of base(V1)

Molarity of acid(M2) = (Molarity of base(M1) x Volume of base(V1)) / Volume of acid(V2)

Therefore,

M1V1 = M2V2
where M1 and V1 are the molarity and volume of NaOH, and M2 and V2 are the molarity and volume of HCl.

Given:
M1 = 0.212 M (NaOH)
V1 = 25.0 mL (NaOH)
V2 = 13.6 mL (HCl)

You need to find M2 (molarity of HCl).

Step 1: Rearrange the formula to solve for M2:
M2 = (M1V1) / V2

Step 2: Plug in the given values:
M2 = (0.212 M * 25.0 mL) / 13.6 mL

Step 3: Calculate the result:
M2 ≈ 0.390 M

So, the molarity of the HCl solution is approximately 0.390 M.

Learn more about molarity here:

brainly.com/question/2817451

#SPJ11

What type of erosion and deposition is not a major force in Texas

Answers

Best answers I could come up with
Gravity
Glaciers
Wind
Water

What are the chemical and biological indicators of water quality?

Answers

The chemical and biological indicators of water quality are substances that are used to measure the quality of water.

These indicators help to identify the presence of pollutants and other contaminants in water. Some common chemical indicators of water quality include pH, dissolved oxygen, total dissolved solids, and salinity. pH is a measure of the acidity or alkalinity of water, and can indicate the presence of pollutants such as acid rain.

Dissolved oxygen levels can indicate the level of organic matter in the water, while total dissolved solids can indicate the presence of pollutants such as salt. Salinity levels can indicate the presence of pollutants such as chloride.

Biological indicators of water quality include the presence of bacteria, viruses, and other microorganisms. These indicators can help to identify the presence of pathogens that can cause disease in humans and other animals. Some common biological indicators of water quality include fecal coliform bacteria, E. coli, and Giardia.

The presence of these organisms in water can indicate the presence of pollutants such as sewage or animal waste.

Learn more about pH here:

https://brainly.com/question/26856926

#SPJ11




A mixture of oxygen (O2), carbon dioxide (CO2), and nitrogen (N2) has a total


pressure of 0. 97 atm. What is the partial pressure of O2, if the partial pressure


of CO2 is 0. 70 atm and the partial pressure of N2 is 0. 12 atm?

Answers

The partial pressure of oxygen (O₂) in the mixture is 0.15 atm.

The partial pressure of oxygen (O₂) can be found using the equation:

Total pressure = Partial pressure of O₂ + Partial pressure of CO₂ + Partial pressure of N₂

Or, mathematically:

P_total = P_O₂ + P_CO₂ + P_N₂

We are given that the total pressure is 0.97 atm, the partial pressure of CO₂ is 0.70 atm, and the partial pressure of N₂ is 0.12 atm. Substituting these values into equation, we get:

0.97 atm = P_O₂ + 0.70 atm + 0.12 atm

Simplifying:

0.97 atm = P_O₂ + 0.82 atm

Subtracting 0.82 atm from both sides:

0.97 atm - 0.82 atm = P_O₂

0.15 atm = P_O₂

To know more about partial pressure here

https://brainly.com/question/13199169

#SPJ4

Based on what you know about Mercury, select all of the correct statements from the following list.

- Mercury does not rotate.

- Mercury has a weak magnetic field.

- Mercury currently has active lava flows filling up some impact craters.

- Being larger than the Moon, Mercury is able to retain an atmosphere.

- Mercury is geologically active.

- Mercury contains a large proportion of dense metals.

- Like the Moon, Mercury has many impact craters.

Answers

The following correct statements are

- Mercury has a weak magnetic field.

- Being larger than the Moon, Mercury is able to retain an atmosphere.

- Mercury is geologically active.

Mercury contains a large proportion of dense metals.

- Like the Moon, Mercury has many impact craters.

What is mercury?

The smallest and nearest planet to the Sun in the Solar System is Mercury. The quickest of the Sun's planets, its orbit takes place in 87.97 Earth days. Mercury does not have any moons.

What qualities does mercury have?

Mercury's and the Moon's surfaces are dominated by impact craters. Both bodies don't have liquid water on their surfaces, which would eventually erode impact craters. Additionally, they lack an atmosphere, which on worlds like the Earth and Venus may vaporize meteoroids before they hit the surface, preventing them from causing damage. Mercury is a highly heavy, dense metal that is silver-white and liquid at normal temperature. Intense volcanism formerly existed on the innermost planet, but a recent study indicates that it stopped some 3.5 billion years ago.

Hence, the statement b, d,e,f are correct

To know are about mercury, visit:

https://brainly.com/question/15465664

#SPJ1

PLSS I NEED HELP
WILL GIVE A LOT

PLSS I NEED HELPWILL GIVE A LOT

Answers

For the reactions shown;
a) MgCl2 + H2SO4 → MgSO4 + 2 HCl

c) 6K + Al2O3 → 3K2O + 2Al

d) 2H2O ----> 2H2 + O2

e) 2C4H10 + 13O2 → 8CO2 + 10H2O

f) will not proceed

g) Will proceed

h) Will proceed

i) Will not proceed

j) Will not proceed

What is a balanced chemical reaction?

A balanced chemical reaction is a chemical equation that represents equal numbers of atoms of each element involved in the reaction, ensuring that the same amount of matter is present before and after the reaction takes place. The coefficients in the equation indicate the relative proportions of reactants and products.

In the case of the replacement reactions, we know that the substance that is higher in the electrochemical series will replace the substance that is lower in the series as shown.

Learn more about reaction:https://brainly.com/question/28984750

#SPJ1

ice added to a hot soup for the purpose must be made from what type of water

Answers

When adding ice to a hot soup, it is generally recommended to use ice made from potable or drinkable water.

The water used to make the ice should be clean and free from any contaminants that could affect the taste or safety of the soup.

It is advisable to use filtered or purify water to make the ice to ensure that it is of good quality. This helps prevent any unwanted flavors or impurities from transferring to the soup.

Using tap water can also be acceptable if it meets the drinking water standards in your area and is considered safe for consumption. However, if you have concerns about the quality of your tap water, using filtered water is a safer option.

Ultimately, the goal is to add ice made from water that is safe and of good quality to avoid any negative impact on the taste or safety of the soup.

To know more about purify water here

https://brainly.com/question/13704419

#SPJ4

g one of the hazards of nuclear explosions is the generation of 90 sr and its subsequent incorporation in place of calcium in bones. this nuclide emits b particles of energy 0.55 mev and has a half-life of 28.1 a (1 a is the si unit 1 annum, for 1 year). suppose 1.00 mg was absorbed by a newborn child. how much will remain after (a) 19 a and (b) 75 a if none is lost metabolically?

Answers

The amount of Sr90 remained after a) 19 a is 0.625 x 10^-6 g and after 75 a is 0.157 x 10^-6 g. This emission is known as radioactive decay.

What is radioactive decay?

Radioactive decay is a process in which any unstable nucleus loses its energy in the form of radiation. Different types of decays include beta decay, alpha decay and gamma decay in which there is a loss of one or more molecule in the form of radiation.

In radioactive decay,  half life of any atomic nuclei is  the time in which the nucleus becomes half of its initial mass.

λ = 0.693 / t1/2 = 0.693 / 28.1 per year.

t = [2.303 /λ] * log [a / a-x]

a) 19 = [2.303/ 0.693] * 28.1 * log [10^-6 / a-x]

0.203 = log [10^-6 / a-x]

a - x = 0.625 x 10^-6 g

b) 75 = [2.303/ 0.693] * 28.1 * log [10^-6 / a-x]

0.803 = log [10^-6 / a-x]

a - x = 0.157 x 10^-6 g

Therefore, the amount of Sr90 remained after a) 19 a is  0.625 x 10^-6 g and after 75 a is 0.157 x 10^-6 g. This process is done by beta decay.

To know more about radioactive decay click on the given link https://brainly.com/question/1236735

#SPJ4

for class ten:
compare and contrast between Mendeleev's periodic table and Moseley's periodic table.

Answers

Answer:

Mendeleev’s periodic table is, based on the relation of elements’ properties as dependent on the atomic weight of the element. But the Modern periodic table considers atomic number as the fundamental property that decides the properties of elements.

The modern periodic table does correct the defects of Mendeleev’s periodic table. For example, in Mendeleev’s periodic table, in the element pairs, Argon-potassium, cobalt-nickel, tellurium-iodine and thorium and protactinium, elements with higher atomic mass precede the element with lower atomic weight. However, it is the right places for them but is against Mendeleev’s periodic law.

These elements atomic number shows the reverse order compared to atomic mass. The supposed to be wrong positions in Mendeleev’s table has the right explanation justifying their positions.

Copper is made of two isotopes. Copper-63 is 69.17% abundant and it has a mass of 62.9296 amu. Copper-65 is 30.83% abundant and it has a mass of 64.9278 amu. What is the weighted average mass of these two isotopes?

Answers

Answer: The average atomic mass of copper is 65.5456 amu.

Explanation: Average atomic mass of an element is defined as the sum of masses of each isotope each multiplied by their natural fractional abundance.

Formula used to calculate average atomic mass follows:

   .....(1)

For  isotope:

Mass of  isotope = 62.9296 amu

Percentage abundance of  isotope = 69.17 %

Fractional abundance of  isotope = 0.6917

For  isotope:

Mass of  isotope = 64.9278 amu

Percentage abundance of  isotope = 30.83%

Fractional abundance of  isotope = 0.3083

Putting values in equation 1, we get:

Thus, the average atomic mass of copper is 65.5456 amu.

160 cm³ of ethyl alcohol has a mass of 126.4 grams. What is the density of this alcohol?

1.27 g/cm³

1.8 g/cm³

1.0 g/cm³

0.79 g/cm³

Answers

Answer: 1.27 g/cm3

Explanation:

160cm3/126.4 grams

In the reaction between 2-chloro-2-methyl propane and silver nitrate in ethanol, what would happen if you added double the amount of: a) 2-chloro-2-methylpropane; or b) silver nitrate? Explain.

Answers

In the reaction between 2-chloro-2-methyl propane and silver nitrate in ethanol, if double the amount of 2-chloro-2-methylpropane is added the reaction would still proceed but if double the amount of silver nitrate is added the reaction will halt.


The reaction would continue but there would be an excess of 2-chloro-2-methyl propane if the amount of 2-chloro-2-methyl propane was doubled. This means that all of the silver nitrate would react with the available 2-chloro-2-methyl propane, but there would still be some unreacted 2-chloro-2-methyl propane left in the solution.

The rate of reaction might increase slightly due to the increased concentration of reactants, but the overall outcome would still be the same: formation of the alkyl nitrate product.

The process would stop if there was a double the amount of silver nitrate added because a precipitate would be formed. This is because silver nitrate reacts with 2-chloro-2-methylpropane to form a white precipitate of silver chloride, which is insoluble in ethanol.

Adding excess silver nitrate would result in the formation of more silver chloride, which would then precipitate out of the solution, thereby halting the reaction.

To learn more about silver nitrate visit:

https://brainly.com/question/29426334

#SPJ11

10.8 g of aluminium reacts with excess oxygen to form aluminium oxide: 4Al + 3O2 → 2Al2O3. What is the theoretical yield of aluminium oxide? (Relative masses: Al = 27.0, Al2O3 = 102.0)​

Answers

Answer:

Theoretical yield = 40.8g

Explanation:

4Al + 3O2 ----] 2Al2O3

if 27.0g of Al ----] 102.0g of 2Al2O3therefore 10.8g -----] xg

10.8g×102.0g/ 27.0g

theoretical yield = 40.8 g

Answer:

20.410 grams of Al2O3 are produced

Explanation:

First, we need to calculate the number of moles of aluminum that are actually reacting..

     We will convert from grams to moles using the atomic weight which (for aluminum) is 26.982 g/mol (which can also be rewritten as 1 mol/26.982)

10.8 g Al * 1 mol Al/26.982 g Al = 0.4002668446 moles Al

**Grams cancel out, so we are left with moles

(I would type this differently so that it would make more sense visually, however brainly is giving me errors, so try writing it out yourself if it doesn't initially make sense..put the equation in fraction form)

     Now that we have the moles of Al, we will convert from moles of Al reacting to moles of aluminum oxide produced..

To do this we will use the balanced chemical equation..

4Al + 3O2 -> 2Al2O3

Using the balanced chemical equation, we can see that for every 4 moles of aluminum that react, 2 moles of aluminum oxide are produced..

0.4002668446 moles Al * 2 mol Al2O3 / 4 mol Al

= 0.2001334223 moles Al2O3..

Now we need to convert from moles of Al2O3 to grams..

We can do this using the atomic weight of Al2O3..

The atomic weight of Al2O3 is 101.961 g/mol or 1 mol/101.961 grams

Now we will convert to grams of Al2O3...

0.2001334223 moles Al2O3 * 101.961 grams Al2O3/1 mol Al2O3

= 20.40580387..

20.410 grams of Al2O3 are produced

Calculate the mass of ammonium sulfide (NH4)2S in 3.00 L of a 0.0200 M solution.

Answers

The mass of (NH4) 2S in the solution is : Mass = 0.0600 mol × 60.08 g/mol = 3.60 g.

The given molarity and volume of the solution can be used to calculate the number of moles of ammonium sulfide (NH4)2S.Then, the number of moles can be converted to mass using the molar mass of (NH4)2S.Mass of ammonium sulfide (NH4)2S in 3.00 L of a 0.0200 M solution is given by : Mass = moles × molar mass.The number of moles of (NH4)2S can be found using the equation:Molarity = Number of moles / Volume.Rearranging this equation, we get:Number of moles = Molarity × Volume Number of moles of (NH4)2S = 0.0200 M × 3.00 L.Number of moles of (NH4)2S = 0.0600 mol.The molar mass of (NH4)2S can be calculated by summing the molar masses of ammonium (NH4) and sulfide (S) ions.Molar mass of (NH4)2S = (2 × Molar mass of NH4) + Molar mass of S= (2 × 14.01 g/mol) + 32.06 g/mol= 60.08 g/mol.

For more question on mass

https://brainly.com/question/1838164

#SPJ8

A catalyst can only be used once.
True
False

Answers

The question is false

Answer:

False

Explanation:

Catalysts are reusable because they keep the chemical reactions moving without being consumed.

For each of A - E above, give an example of a type of evidence you could collect from that item and how you would collect it. (one to two sentences each)
A. Tire tracks/skid marks left on the pavement B. Deep red scrapes across the Camaro's panels and green scrapes across the Toyota's panels
C. Broken car window
D. Fragments of a hood or panel
E. A torn rag​

Answers

A. Tire tracks/skid marks left on the pavement: To collect evidence from tire tracks or skid marks, a photograph should be taken as it is

B. Deep red scrapes across the Camaro's panels and green scrapes across the Toyota's panels: Using a magnifying glass, the crime scene technician may observe and photograph the red and green paint.

C. Broken car window: Photographs of the shattered glass should be taken and glass fragments should be collected for examination under a microscope.

D. Fragments of a hood or panel: The fragments should be marked for future identification and then collected for examination under a microscope.

E. A torn rag: The rag should be placed in a paper bag for transport to the lab, and its contents should be recorded.

A. Tire tracks/skid marks left on the pavement: To collect evidence from tire tracks or skid marks, a photograph should be taken as it is. A cast of the track or a replica of the impression can also be made using dental stone, plasticine, or silicone rubber. B. Deep red scrapes across the Camaro's panels and green scrapes across the Toyota's panels: Using a magnifying glass, the crime scene technician may observe and photograph the red and green paint. The fragments of paint will be collected using a scalpel and an adhesive medium to obtain their chemical composition. C. Broken car window: Photographs of the shattered glass should be taken and glass fragments should be collected for examination under a microscope. The window can be wrapped in a sheet of paper and tape for collection. D. Fragments of a hood or panel: The fragments should be marked for future identification and then collected for examination under a microscope. The fragments should be placed in paper bags, which should then be sealed and labeled. E. A torn rag: The rag should be placed in a paper bag for transport to the lab, and its contents should be recorded. Under a microscope, the rag can be examined and any hair, fibers, or DNA present can be collected for further analysis and comparison.

For more question on microscope

https://brainly.com/question/29299954

#SPJ8

Select the answer with the correct number of significant figures for each calculation. 31.580 + 4.26 = 35.8 35.84 35.840

Answers

Answer: 35.84

Explanation: Look at the most uncertain number and your sum should have the same number of decimal places as that. In this case it is 4.26 which as 2 numbers following the decimal point, so your answer should too.

(b)
Huiting wanted to find out the hardness of two materials H and F. She used a
rounded object made of material G and forced it into each material with the
same force. The results of her experiment are shown below.
rounded object of
material G
rounded object
of material G
3 mm
1 mm
object of
material H
object of
material F
List materials F, G, H in increasing order of hardness. Explain your answer.
[2]​

Answers

Object named H is harder than Object F due to its thickness.

The object of material H is harder than the object of material F due to the difference in thickness. The thickness of Material Object H is 3 millimeters compared to Material Object F which is 1 millimeter thick, so applying the same amount of force on both objects, Material Object H does not show any change in its structure while on the other hand, the shape of the object F changes due to a lower hardness.

https://brainly.com/question/24333064

Other Questions
most of the body's phosphorus is stored in: group of answer choices the liver. adipose tissue. the skeleton. the kidneys. A vapour compression refrigeration system uses R 134a as its working fluid. The vapour enters the compressor suction dry saturated at 2.0060 bar. Compression is isentropic and the condenser pressure is 5.7162 bar. Calculate: (a) The refrigerating effect. (b) The compressor work (c) The Coefficient of Performance (6) (10) (4) Evaluate the expression when x=10, y=2, and z=5. Enterprise, Inc bonds have an annual coupon rate of 9 percent. The interest is paid semiannually and the bonds mature in 8 years. Their par value is $1,000 if the markar's required yield to maturity on a comparable-nske and is 8 percent, what is the value of the bond? What is its value if the interest is paid annually? The value of the Enterprise bonds if the interest is paid semanually is (Round to the nearest cent) 2. Lines 11-20 Imply a contrast berween America and apolitical parry similar country restricted societyd. friendly neighborhood Water is the working fluid in an ideal Rankine cycle. Superheated vapor enters the turbine at 10 MPa, 480C, and the condenser pressure is 6 kPa. Isentropic efficiencies of the turbine and pump are 84% and 73%, respectively. Determine for the cycle a. the heat transfer to the working fluid passing through the steam generator, in kJ per kg of steam flowing. b. the thermal efficiency. c. the heat transfer from the working fluid passing through the condenser to the cooling water, in kJ per kg of steam flowing. _____ is the process of grouping jobs together so that similar or associated tasks and activities can be coordinated. five plus six is equal to? A qu hora sales de la practica?Yo tengo a las cinco de la tarde.Yo puedo a las cinco de la tarde.Yo estoy a las cinco de la tarde. Yo salgo a las cinco de la tarde. A beach has two floating docks. one is 650 meters east of the lifeguard stand. the other is 60 southeast and 750 meters from the lifeguard stand. law of cosines: a triangle is created between a lifeguard stand and 2 floating docks. the distance from the lifeguard stand to one dock is 750 meters, and the distance to the second dock is 650 meters. the angle between the 2 sides is 60 degrees. rounded to the nearest meter, what is the distance between the docks? round to the nearest meter. when do we say that a person has misattributed his arousal? a. when the emotions generated from the arousal are negative b. when the emotions generated from the arousal are positive c. when he is aware of the cause of his arousal d. when he incorrectly labels the source of the arousal Felipe is having friends over for dinner. One of his guests has celiac disease. Which one would best entree for Felipe to serve? A. garlic shrimp on top of brown rice B. homemade pizza with basil, tomato, mozzarella C. coconut curry with naan bread D. roasted turkey with stuffing When viewed from the window of a moving train, nearby objects seem to pass by more quickly than do more distant objects. This cue for depth perception is called. Which statements are true about the ordered pair (10, 5) and the system of equations?{2x5y=5x+2y=11Select each correct answer.A. The ordered pair (10, 5) is a solution to the first equation because it makes the first equation true.B. The ordered pair (10, 5) is a solution to the second equation because it makes the second equation true.C. The ordered pair (10, 5) is not a solution to the system because it makes at least one of the equations false.D. The ordered pair (10, 5) is a solution to the system because it makes both equations true. What principle of U.S. government is described below....1. Congress passes bill2. President signs bill into law3. Supreme Court rules new law unconstitutional A triangle has an area of 20ft the base is 10 feet. What's the height? (I'll give brainliest.) on march 15, viking office supply agrees to accept $1,200 in cash along with a $2,800, 60-day, 15 percent note from one of its customers to settle his $4,000 past-due account. How did the movie domestic scenes contrast with the ones focused on langley? The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below: AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTCT CTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAGHow many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI? a. two b. three c. four d. five Describe a situation where you made your best first impression. What did you do right?Your response should be 1-2 paragraphs