Which piece of laboratory equipment would be used to contain a substance while it heats or melts?

Mortar and pestle
Crucible
Balance scale
Graduated cylinder

Answers

Answer 1

Answer:

The correct answer is Crucible

Explanation:

have a great day


Related Questions

why is the vegetation at the bottom of mountains generally not the same as vegetation found at higher altitudes on mountains

Answers

Because of the moisture and height difference so some can provide more coldness while the other could be hot

Do you agree with Dr. Walker and his colleagues that the changes to Jordan Jones’s meal could not explain his improved performance? Why or why not?

Answers

Answer: I agree with Dr. Walker and his colleagues that the changes to Jordan Jones’s meal could not explain his improved performance.

Explanation:  I agree with Dr. Walker and his colleagues that the changes to Jordan Jones’s meal could not explain his improved performance because, food can´t change anything except for your hungriness, and the more food you eat the more fat you get, and not slim.

according to the data in model 1, how many males are 181 cm or above in height

Answers

Answer:

9 male individuals are 181 cm or above in height.

Explanation:

You will find model 1 in the attached file.

In the model, you can see a pie chart, a bar graph, and a line graph.

The pie graph shows an approximate proportion of males and females with different highs. What is wrong about this chart is that it does not show the percentages of males and females by heigh. Anyway, we can not answer the question with the given information. The bar graph expresses a comparison between males´ and females´ average height, hand length, and knuckles values. According to this graph, we can not know how many males were 181 cm or taller.The line graph shows the distribution of height in bales and females. Females are represented by a continous line, while males are represented by a pointed-line. So we need to focus on this line to answer the question. The Y-axes shows the number of individuals, and the X-axes shows the heights intervals in centimeters. According to the question, we need to look for the interval that belongs to 181 cm and above. So, the interval between 181-185 cm height corresponds to 6 male individuals. But after that interval, we also have 3 more male individuals that are between a height of 186-190 cm. So, in total, we have 9 male individuals that are 181 cm or above in height.
according to the data in model 1, how many males are 181 cm or above in height

Describe the survival strategy of the wasp

Answers

Some of the key survival strategies of wasps include aggression and defense, efficient foraging, social behavior, adaptive nesting strategies, and reproductive strategies. These strategies have helped wasps thrive in a wide range of environments.

Wasps are highly aggressive and have powerful stingers that they use to defend themselves and their nests from predators. Many wasp species also have sharp mandibles that they use for biting and tearing apart prey. Wasps are opportunistic foragers and are able to efficiently locate and collect food. Some wasps hunt and capture other insects, while others feed on nectar and fruit. Many wasp species are highly social and live in large colonies or nests.

Learn more about the wasp here.

https://brainly.com/question/31599306

#SPJ1

Help please I’ll give brainliest only if you are right

Help please Ill give brainliest only if you are right

Answers

Answer:

1 st question ) Lack of food and oxygen and the presence of wastes limit their growth.

For brainly !!

Give an example of seedless vascular plants

Answers

Answer:

one of them would be ferns

Which living animal is most closely related to Cetaceans such as whales?

Answers

answer explanation:

Hippos and whales may look different in many ways, but they are actually each others' closest living relatives—sharing a common ancestor that lived about 55 million years ago.

Hippopotamus furthermore, the DNA testing revealed that whales share a DNA sequence found only in one other animal – indicating that among all the non-whale mammals alive today, whales' closest living relatives are none other than hippopotamus!

A mitochondrion is having a problem creating enough energy to build new molecules. Which problem most likely exists with the mitochondrion

Answers

When a mitochondrion is not creating enough energy to build new molecules the reason for this is proton pump is not working properly .

Enzyme in mitochondrial respiratory chains works as proton pump, they use energy to transfer protons across the inner mitochondrial membrane and create an electrochemical gradient used for the production of ATP.

The energy used in the electron transport chain pumps protons across the inner mitochondrial membrane from the inner matrix to the intermembrane space, producing a strong hydrogen concentration gradient. Defect in creating this hydrogen concentration gradient often results in less energy production .

To learn more about mitochondrion , here

brainly.com/question/17091391

#SPJ1

how does an algal bloom affect the oxygen content of the water? an algal bloom will cause the oxygen content in the water to decrease overall. an algal bloom will cause the oxygen content in the water to decrease, leading to hy

Answers

The algae bloom will cause the oxygen content in the water to decrease, leading to hypoxic conditions.

An algal bloom, also known as an algae bloom, is a rapid increase or accumulation of algae populations in freshwater or marine water systems. The discoloration in the water caused by the algae's pigments is often used to identify it. The term algae refers to a wide range of aquatic photosynthetic organisms, including macroscopic multicellular organisms such as seaweed and microscopic unicellular organisms such as cyanobacteria. Algal bloom is commonly used to describe the rapid growth of microscopic unicellular algae rather than macroscopic algae.

Algae blooms can occur when a number of favorable environmental conditions for abundant algal growth exist (e.g., increased nutrients, warmer temperature, abundant light, and stable wind conditions).

To learn more about algae bloom, here

https://brainly.com/question/725774

#SPJ4

What additional information would you want to know to understand Emma and Jacob's panic? Include a minimum of three examples.

Answers

The correct answer to this open question is the following.

Unfortunately, you did not attach the story, the text, or the name of the article/text. Without this important information is so difficult to help you.

However, trying to help you, we did some deep search and can comment on the following.

The additional information you would want to know to understand Emma and Jacob's panic is the following.

First, you want to understand what is the real cause of the parent's panic. And all comes down to the health of their baby. The baby had problems with feeding. What happened was that Emma's baby stopped feeding after seven days.

This couple had lost a baby that died in the first nine days with no clear explanations at all. So they were traumatized by that fact and do not want to have another traumatic experience again. That is why they are afraid.

The parents desire the baby to feed normally and have the correct weight.

Parents are afraid that the baby dies or if it survives, could end up with some illness or mental ret*rdation, or could have another kind of complications when the baby is growing up.

I have only two hats, a red one and a black one. I have only two
belts, a blue one and a white one. I have only two ties, one with a
DNA molecule prominently showing on it and the other with
2n promin

Answers

As per the details given, using probability there are 8 possible combinations of hats, belts, and ties.

You need to know the entire number of possible combinations and the total number of positive outcomes in order to determine the likelihood of a certain arrangement of hats, belts, and ties happening.

You may get the total number of combinations by multiplying the number of options for each item (hats, belts, and ties), as each has two options.

In this instance, you have two hat options (red or black), two belt options (blue or white), and two tie possibilities (DNA or 2n). Consequently, there are the following combinations in all:

2 (options for hat) * 2 (options for belt) * 2 (options for tie) = \(2^3\) = 8

Thus, there are 8 possible combinations of hats, belts, and ties.

For more details regarding probability, visit:

https://brainly.com/question/31828911

#SPJ4

Your question seems incomplete, the probable complete question is:

I have only two hats, a red one and a black one. I have only two belts, a blue one and a white one. I have only two ties, one with a DNA molecule prominently showing on it and the other with 2n prominently showing on it. Every day I wear one hat, one belt and one tie, all chosen at random. How many possible combinations of hats, belts and ties exist?

which nutrients often limit the distribution and abundance of photosynthetic organisms? select all that apply.

Answers

For nutrients like nitrogen or phosphorus are frequently a source of restriction for photosynthetic organisms (like kelp or phytoplankton).

While phosphorus (P) limitation typically occurs in tropical locations, nitrogen (N) is generally regarded as the primary limiting component in temperate regions. However, nutrient limitation in subtropical regions is little known.

Nitrogen (N), phosphorus (P), and potassium are the three main limiting nutrients in crop yield (K). These three nutrients are frequently added as parts of commercial fertiliser or manure to agricultural areas. You need to understand that the three limiting parameters for photosynthesis are light intensity, CO2 concentration, and temperature. Although a scarcity of water can slow down photosynthesis, other plant functions are typically affected before photosynthesis

To learn more about photosynthetic  please click on below link

https://brainly.com/question/5870637

#SPJ4

Which statement about the cell membrane is true?

A) It contains cellulose and sugars that are involved in communication.

B) It is present in animal cells only.

C) It is rigid and elastic for supporting the cell's shape.

D) It prevents harmful substances from entering a cell.

Answers

Answer:

Its D, The cell membrane(also known a the plasma membrane) has a job in which it has to allow passage in and out of the cell. Therefore it can prevent harmful substances from entering the cell. Think of it as security, either allowing you access or denying you depending on if you're a threat

Answer:

D) it prevents harmful substances from entering a cell

Explanation:

The entire purpose of the cells membrane is to contain its organelles, the structures within it and prevent them from getting harmed by outside material.

6. Which division of the ANS is characterized by long preganglionic and short postganglionic fibers?

A. Thoracolumbar

B. Craniosacral

C. Somatosensory

D. Somatic motor

7. Which statement comparing the autonomic and somatic nervous systems is not true?

A. Both the autonomic and somatic divisions carry motor fibers.

B. The somatic motor division is strictly voluntary and the autonomic division is completely involuntary.

C. The primary effectors of the ANS are viscera of the abdominal and thoracic cavities in contrast to the

somatic motor division, which targets skeletal muscles.

D. The somatic motor division requires one neuron to reach an effector in contrast to the ANS, which

requires two neurons to cause an effect.

8. The sympathetic division of the ANS reduces blood flow to which of the following?

A. The skin

B. The skeletal muscles

C. The heart

D. The lungs

E. The brain

Answers

6. The division of the ANS that is characterized by long preganglionic and short postganglionic fibers is A) Thoracolumbar.

7. The statement that is not true when comparing the autonomic and somatic nervous systems is B) The somatic motor division is strictly voluntary and the autonomic division is completely involuntary. This is because the somatic motor division is indeed voluntary, but the autonomic division can be both voluntary (in certain situations) and involuntary.

8. The sympathetic division of the ANS reduces blood flow to A) the skin and B) the skeletal muscles. This is because during the "fight or flight" response, blood is redirected towards the internal organs and away from the skin and skeletal muscles. However, the sympathetic division increases blood flow to C) the heart, D) the lungs, and E) the brain, in order to increase oxygen and nutrient supply to these organs during times of stress.
6. The division of the ANS characterized by long preganglionic and short postganglionic fibers is B. Craniosacral.

7. The statement comparing the autonomic and somatic nervous systems that is not true is B. The somatic motor division is strictly voluntary and the autonomic division is completely involuntary.

8. The sympathetic division of the ANS reduces blood flow to A. The skin.

To know more about preganglionic visit:-

https://brainly.com/question/28020218

#SPJ11

Which of these foods provides all of the essential amino acids your body needs?

A) Apples
B) Eggs
C) Pasta
D) Peas

Answers

B. Eggs
Have a good day hope this helps!

2
Drag each label to the correct location. Not all labels will be used.
Identify the boundary type that is being described.
oceanic-oceanic convergent
boundary
oceanic-oceanic divergent
boundary
transform boundary
At this boundary, crust is neither
created nor destroyed.
Movement along this boundary leads
to crumpling, lifting, and folding of
Earth's crust in the area where the
plates are in contact.
An arc of volcanic islands is often
formed in the subduction zone at
this boundary.
continental-continental convergent
boundary
Boundary Type

Answers

The type of boundary described as follows 1. Transform boundaries. 2.  continental Convergent boundary. 3. oceanic convergent boundary.

What are the 3 types of plate boundaries ?

Divergent boundaries -- where new crust is generated as the plates pull away from each other.

Convergent boundaries -- where crust is destroyed as one plate dives under another.

Transform boundaries -- where crust is neither produced nor destroyed as the plates slide horizontally past each other.

Hence, The type of boundary described in the given question are as follows 1. Transform boundaries. 2.  continental Convergent boundary. 3. oceanic convergent boundary.

Learn more about plate boundaries here ;

https://brainly.com/question/18256552

#SPJ1

Bears expend about 25×106 J/day25×106 J/day during periods of hibernation, which may last as long as 77 months. They obtain the energy required to sustain life from fatty acid oxidation. How much weight (in kilograms) do bears lose after 77 months of hibernation? (Assume the oxidation of fat yields 38 kJ/g.38 kJ/g.)
How could a bear's body minimize ketosis during hibernation?
A. Increasing insulin secretion could reduce fatty acid oxidation by allowing for more efficient use of glucose.
B. Upregulation of citric acid cycle enzymes could reduce the shunting of acetyl‑CoA into ketone body formation.
C. Using acetyl‑CoA to fuel gluconeogenesis could reduce the amount of acetyl‑CoA available for ketone body formation.
D. Degradation of nonessential body proteins could supply amino acid skeletons for gluconeogenesis.

Answers

A bear's body could minimize ketosis during hibernation that expend about 25 × 10⁶ J/day, which may last as long as 77 months is upregulation of citric acid cycle enzymes could reduce the shunting of acetyl‑CoA into ketone body formation (Option B).

Using the given information, we can calculate the total energy expended by a bear during 77 months of hibernation as follows:

Total energy expended = 25×10⁶ J/day x 30 days/month x 77 months

= 57.75×10¹⁰ J

We can then use the energy yield of fatty acid oxidation to calculate the total amount of fat oxidized by the bear during this period:

Fat oxidized = Total energy expended / Energy yield of fat oxidation

= 57.75×10¹⁰ J / 38 kJ/g

= 1.52×10⁹ g

Finally, we can convert this to kilograms by dividing by 1000:

Weight lost = Fat oxidized / 1000

= 1.52×106 kg

Therefore, the bear would lose approximately 1.52 million kilograms of weight during 77 months of hibernation.

To minimize ketosis during hibernation, option B is the most likely answer. Upregulation of citric acid cycle enzymes would increase the utilization of acetyl‑CoA for energy production, reducing the availability of acetyl‑CoA for ketone body formation.

Learn more about ketosis: https://brainly.com/question/29348959

#SPJ11

PLS HELP 20 POINTS IF YOU GET IT RIGHT AND BRAINLSIT.

% of possible Genotypes:

FF: ? Ff: ? ff: ?

% of possible Phenotypes:

Black fur: ? Grey fur: ?

PLS HELP 20 POINTS IF YOU GET IT RIGHT AND BRAINLSIT. % of possible Genotypes:FF: ? Ff: ? ff: ? % of

Answers

This is essentially the punnet square you’re looking at (just f instead of g)
So 0% FF, 50% Ff, and 50% ff
Anything with F corresponds to Grey fur while if ff it’s black fur.
You don’t have FF do you don’t need to worry about that right now
50% grey fur and 50% black fur
PLS HELP 20 POINTS IF YOU GET IT RIGHT AND BRAINLSIT. % of possible Genotypes:FF: ? Ff: ? ff: ? % of

how does a healthy environment help in maintaining happy and prosperous life in long type​

Answers

If it is a healthy environment then the atmosphere will be happy meaning no dirty streets etc

According to the food web below, what is the phytoplankton?

According to the food web below, what is the phytoplankton?

Answers

your correct answer should be producer

А
cholesterol
B
phospholipid
C
saturated fatty acid
D
unsaturated fatty acid

cholesterolBphospholipidCsaturated fatty acidDunsaturated fatty acid

Answers

Answer:

D) Unsaturated fatty acid

Please help!! Question is down below!!

Please help!! Question is down below!!

Answers

Answer:

its answer three

Explanation:

organic compounds are to large to defuse into the cell, proteins are digested into simple sugars and starches are digested into amino acid.

hope this helps :)

-by chance may i get brainliest

Two plates moving towards each other are called convergent plates. Which
structures are likely to form at a convergent plate boundary?
A:rift valley
B:wave erosion
C:mountains
D:river canyons

Two plates moving towards each other are called convergent plates. Whichstructures are likely to form

Answers

C: Mountains.

Explanation: The two plates collide and push up against each other, forming the mountains

Mountains are formed when two convergent plates move towards each other. Therefore, option C is correct.

What are convergent pates?

A convergent plate boundary is a type of tectonic plate boundary where two tectonic plates are moving toward each other. As the plates move, they can collide, resulting in the formation of various geological features and processes, such as mountain ranges, volcanic eruptions, and earthquakes.

Convergent plate boundaries are one of the three main types of plate boundaries, along with divergent and transform plate boundaries. They are important in shaping the Earth's surface and are associated with some of the most spectacular geological features on the planet.

Thus, mountains are formed when two convergent plates move toward each other. Therefore, option C is correct.

Learn more about convergent plates, here:

https://brainly.com/question/23845744

#SPJ2

How does the substance in a mudflow form?

Rain mixes with soil.
Large rocks mix with water.
Soil and paper debris are combined.
Loosely connected rocks bind together.​

Answers

Answer:

hi the answer is a)rain mixes with soil

have a nice day

Explanation:

Answer:

a Rain mixes with soil.

Explanation:

i took the test

The Diagram shows structures that form the surface of the trachea.
Which level of organisation is the structure labelled S ?
A. Cell
B. Organ
C. Organ system
D. Tissue

The Diagram shows structures that form the surface of the trachea. Which level of organisation is the

Answers

Its the tissue that is labeled s

Structure S is a simple columnar epithelium, which is a type of tissue.

The diagram shows the structures that form the surface of the trachea. The trachea is a tube that carries air from the lungs. The surface of the trachea is lined with a layer of tissue called the epithelium. The epithelium is made up of cells that line the inside of the trachea.

The structure labelled S is a type of epithelium called a simple columnar epithelium. Simple columnar epithelia are made up of cells that are arranged in a single layer. The cells in a simple columnar epithelium are tall and column-shaped.

The simple columnar epithelium in the trachea helps to protect the trachea from infection. The cells in the epithelium produce a mucus that traps dust and other particles. The mucus is then carried away by the cilia, which are tiny hairs that line the trachea.

The other levels of organization in the diagram are organ, organ system, and cell. The trachea is an organ, which is a collection of tissues that work together to perform a specific function. The respiratory system is an organ system, which is a group of organs that work together to perform a common function. Cells are the basic units of life, and they are the building blocks of tissues, organs, and organ systems.

To learn more about level of organisation, here

https://brainly.com/question/880314

#SPJ2

WILL GIVE BAINLESTTTT
The algae beads provide a convenient experimental system because they are uniform in size and contain roughly the same number of algal cells per bead. Why are these advantages for the experiments you will perform?

Answers

Answer:

We will be measuring rates of photosynthesis and cellular respiration and these rates will depend on the number of organelles, or cells, that we use. The algae beads are easy to see, manipulate, and count. A consistent number of beads queal a consistent number of alga cells.

Explanation:

Whale primary functions

Answers

The primary functions of whales include feeding, reproduction, communication, and migration.

Whales are primarily filter feeders or predators, depending on the species.

Filter-feeding whales, such as baleen whales, have baleen plates in their mouths that allow them to filter out small prey, such as krill or small fish, from large volumes of water.

Predatory whales, such as toothed whales, hunt and feed on various marine organisms, including fish, squid, and marine mammals.

Reproduction is another important function for whales. Most whale species have a gestation period of several months, with females giving birth to a single calf.

The calves are nursed with milk from their mothers and rely on their care for a period of time until they become independent.

Communication is vital for whales, as they rely on vocalizations to communicate with other members of their pod.

Whales produce a variety of sounds, including songs, clicks, and whistles, which serve purposes such as mating, social interactions, and navigation.

Migration is a common behavior observed in many whale species. Whales undertake long-distance migrations, often covering thousands of kilometers, to reach feeding grounds in nutrient-rich waters or to reproduce in specific breeding areas.

These migrations are driven by seasonal changes in food availability and environmental conditions.

In summary, the primary functions of whales encompass feeding, reproduction, communication, and migration, all of which are essential for their survival and successful adaptation to their marine environments.

For more such answers on whales

https://brainly.com/question/28623065

#SPJ8

What are the five main functions of bone?

Answers

Answer: The five main functions of bone is that it gives the body its shape, allows movement, makes blood cells, and provides protection for organs and stores minerals.

Explanation:

1. support: body's framework to support organs & muscle as well ad serve as an attachment site for muscles
2. protection: bony cavities around organs, protects heart and lungs, the canal cavity protects the brain
3. movement: bones form joints which provide levers for movement
4: hematopoiesis: (blood cell production) red marrow produces both RBCs and WBCs
5. mineral storage and homeostasis the skeleton forms a reservoir for minerals, especially calcium, for maintenance of homeostasis (Ca+ are essential for nerve impulse conduction)

what would happen if an electric fish was always negatively charged instead?​

Answers

Answer:

Electric eels are part of a group of animals called electric fish.These cells pump positively charged sodium atoms, called ions, from inside themselves to the outside.

Explanation:

Brainliest? plz

Electric fish is a part of the group of animals which are responsible for producing charge. These organisms pump positively charged sodium ions from inside themselves to the outside environment.

What is electric fish?

An electric fish is an fish that can generate electric fields and transfer current through themselves. Most of the electric fishes are electroreceptive, which means that these fishes can sense the electric fields present in the environment. The only exception here is the stargazer family which is not electroreceptive.

The examples of electric fish includes Electric eel, that belongs to the genus Electrophorus, South American knifefishes responsible for the production of powerful electric shocks to stun prey.

If the electric fishes are supplied with the negative charge always then they will pump positive charge to neutralize the effect of that charge.

Learn more about Electric fish here:

https://brainly.com/question/14788080

#SPJ2

Why would organisms evolve to HAVE vestigial body parts

Answers

Explanation:

Structures that have lost their use through evolution are called vestigial structures. They provide evidence for evolution because they suggest that an organism changed from using the structure to not using the structure, or using it for a different purpose..

Hope it will help :)

Other Questions
an employee was injured while at work. in which situation would the case not need to be recorded under osha? conformity, obedience, and compliance are all examples ofquestion 36 options:a) persuasion.b) coercion.c) social learning.d) social influence. a researcher at a large university is examining the relationship between substance abuse and religiosity. the researcher is drawing the sample from the college campus that they work at and has access to student email. the researcher would like to draw a sample of 400 students from the student population. which survey type would be best suited for this study? For a fishing trip, Manuel is going to choose lures to put in his tackle box. He has 7 lures that are spinnerbaits and 4 that are crankbaits. In how many ways can he choose 6 lures if 2 or fewer must be crankbaits an income statement under absorption costing includes all of the following: (you may select more than one answer. single click the box with the question mark to produce a check mark for a correct answer and double click the box with the question mark to empty the box for a wrong answer. any boxes left with a question mark will be automatically graded as incorrect.) check all that apply a. direct materials b. direct laborc. ariable overhead d. fixed overhead Please answer correctly !!!!!!!!!!!!!!! Will mark Brianliest !!!!!!!!!! If you attended a Black church after the Civil War, what might you expect to hear on a Sunday morning in addition to asermon about Jesus? The percentage of floating leaf disks is a reasonable measure of photosynthetic rate because the leaves float due to____ production. a. carbon dioxide b. oxygenc. water d. bicarbonate e. cresol red which costs are actually impacted by the ordering decision? multiple select question. order cost per unit of time holding cost per unit of time purchasing cost per unit of time spoilage cost per unit of time Which osi layer is responsible for providing end-to-end communication with reliable service? Pharoah Manufacturing uses a job-order cost system and applies overhead to production on the basis of direct labour costs. On January 1, 2022, Job No. 50 was the only job in process. The costs incurred prior to January 1 on this job were as follows: direct materials $30,900, direct labour $15,200, and manufacturing overhead $20,400. As at January 1, Job No. 49 had been completed at a cost of $120,700 and was part of finished goods inventory. There was a $25,300 balance in the Raw Materials Inventory account on January 1. During the month of January, Pharoah Manufacturing began production on Jobs 51 and 52, and completed Jobs 50 and 51. Jobs 49 and 50 were sold on account during the month for $152,100 and $198,000, respectively. The following additional events occurred during the month: 1. Pharoah purchased additional raw materials of $105,000 on account. 2. It incurred factory labour costs of $75,900. 3. It incurred manufacturing overhead costs as follows: depreciation on equipment $14,000, and various other manufacturing overhead costs on account $22,900. 4. It assigned direct materials and direct labour to jobs as follows: Direct Materials Direct Labour Job No. 50 $12,400 $7,100 51 42,500 28,000 52 35,400 22,300 5. It assigned indirect materials of $17,400 and indirect labour of $18,400. (e2) Your answer is partially correct. Prepare the journal entry to record the completion of any job(s) during the month. (List all debit entries before credit entries. Credit account titles are automatically indented when the amount is entered. Do not indent manually.) Account Titles and Explanation Debit Credit Accounts Payable 72600 Factory Labour 72600 2. Amelia y Tina(buscar) un apartamento cerca del centro.ded While jennifer was growing up, her mother constantly told her that she needed to watch her weight. as an adult, jennifer thinks of herself as overweight because of? Which of the following statements is FALSE?A. The semicircular canals are each oriented in a different plane: horizontally, vertically, and obliquely.B. The throat is also known as the pharynx.C. The turbinates are three long, bony projections coming off of the hard palate.D. The two openings in the temporal bone that connect the middle ear with the inner ear are the round window and oval window. The quantity of money demanded rises (that is, there is a movement along the money demand curve) when: The Carbondale Hospital is considering the purchase of a new ambulance. The decision will rest partly on the anticipated mileage to be driven next year. The miles driven during the past 5 years are as follows: Year Mileage 1 3,100 2 3,950 3 3 ,500 4 3,850 5 3,700 a) Using a 2-year moving average, the forecast for year 6 = 3775 miles (round your response to the nearest whole number). b) If a 2-year moving average is used to make the forecast, the MAD based on this = 58.3 miles (round your response to one decimal place). (Hint: You will have only 3 years of matched data.) c) The forecast for year 6 using a weighted 2-year moving average with weights of 0.45 and 0.55 (the weight of 0.55 is for the most recent period) = 3768 miles (round your response to the nearest whole number). The MAD for the forecast developed using a weighted 2-year moving average with weights of 0.45 and 0.55 = ||| miles (round your response to one decimal place). (Hint: You will have only 3 years of matched data.) A 12] 3,100 3,950 3 3,500 3,525 -25 1 Year 2 Mileage 3 Forecast 4 Error 5 Absolute error 5 Weight 7 Weighted moving average of 2 years 3 Weighted moving average of 2 years 0.45 and 0.55 3,850 3,725 125 125 0.45 1732.5 5 3,700 3,675 25 25 0.55 2035 25 175 3767.5 58.333333 Suppose a researcher wishes to edit a gene of interest containing the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' . Design the customized portion of an sgRNA for this target DNA sequence: 5' CUCGUUAGGACUAGUUAGCG Use the construction in the proof of Theorem 1.45 to give the state diagrams of NFAs recognizing the union of the languages described ina. Exercises 1.6a and 1.6b.b. Exercises 1.6c and 1.6f.THEOREM 1.45 The class of regular languages is closed under the union operation. What kinds of uniquely human activities show up early in the african archeological record, making the case that humans originated on that continent? To rent a taxi in Los Angeles, the taxi service charges a flat rate of $16.40 and an additional $4.90 per mile driven. In this situation, what is the value of the slope?