Answer:
(C). Increased plasma carbon dioxide (Co2).
Explanation:
Edge
There are three sources of genetic variation in sexual reproduction. Determine which of the following statements accurately describes which of these are considered random and which are not
Genetic recombination and independent assortment are considered random sources of genetic variation, while mutations can occur randomly or due to specific factors.
In sexual reproduction, the three sources of genetic variation are genetic recombination, independent assortment, and random mutations. Among these sources, genetic recombination and independent assortment are considered random processes, while mutations are not entirely random.Genetic recombination occurs during meiosis when homologous chromosomes exchange genetic material through crossing over. This process is considered random as the precise locations where recombination events occur are unpredictable.Independent assortment refers to the random alignment and separation of homologous chromosomes during meiosis I. The random positioning of maternal and paternal chromosomes contributes to genetic diversity in offspring.On the other hand, mutations are not entirely random as they can be influenced by various factors such as exposure to mutagens or errors in DNA replication. However, the specific mutations that occur at particular loci are generally considered random events.Therefore, the accurate statement would be that genetic recombination and independent assortment are considered random sources of genetic variation, while mutations are influenced by both random and non-random factors.For more such questions on Genetic variation:
https://brainly.com/question/23840938
#SPJ8
what function of lipids are essential to living organism
Answer:
Lipids perform three primary biological functions within the body: they serve as structural components of cell membranes, function as energy storehouses, and function as important signaling molecules.
Explanation:
PLEASE MARK AS BRAINLEST
Answer:
Lipids serve multiple functions across species. They function as energy reserves, regulate hormones, cushion vital organs and transport fat- soluble nutrients. Lipids are mainly produced by the smooth endoplasmic reticulum.
Hope this helps.
Mammals have fur, they suckle their young and the young develop inside the mother. is it True or False
Answer:
True
Explanation:
This statement is true.
Mammals are defined by several characteristics, including the presence of fur or hair, the production of milk by the mother to nourish their young (which is known as lactation), and the development of the offspring within the mother's body before birth.
Hope this helps!
What type of gene is only expressed if there are two genes of that type
Answer:
Dominant PhenotypeExplanation:
A dominant phenotype will be expressed when at least one allele of its associated type is present, whereas a recessive phenotype will only be expressed when both alleles are of its associated type. However, there are exceptions to the way heterozygotes express themselves in the phenotype.
Answer:
Recessive Gene
Explanation:
The recessive gene is only expressed if there are two alleles. A recessive allel will only produce a phenotype if there is no dominant allel present. Recessive alleles are represented by lowercase letters, while dominant allels are uppercase.
Which organisms can reproduce using the process of fragmentation
Fragmentation is a form of asexual reproduction and is seen in annelids, fungi, cyanobacteria, sponges, and flatworms.
In Fragmentation, an organism divides itself into a number of fragments. It occurs when an organism completely breaks down independently irrespective of the other parts. Each one of these fragments matures into fully grown adults that are clones of the original organism.
Asexual reproduction usually involves the participation of a single parent alone can produce new offspring. The newly produced individual is genetically identical to one another and its parent. Both multicellular and unicellular organisms divide by fragmentation which is asexual reproduction.
Fragmentation is the most common method of reproduction in lower invertebrates. It is seen in many organisms including filamentous cyanobacteria, algae, lichens, molds, many plants, and animals such as flatworms, annelid worms, sponges, and sea stars.
Learn more about the fragmentation from the given link.
https://brainly.com/question/29633695
The organisms that can reproduce by fragmentation are Option d Sponges and Sea anemones.
Fragmentation is a form of asexual reproduction in which an organism breaks into two or more fragments, and each fragment develops into a new individual. Both sponges and sea anemones are examples of organisms that exhibit this mode of reproduction.
Sponges are simple multicellular animals that lack true tissues and organs. They possess a porous body structure, and when a sponge is fragmented, each fragment has the potential to develop into a new sponge through regeneration. These fragments contain specialized cells called archaeocytes that can differentiate into various cell types required for the formation of a new sponge.
Sea anemones, on the other hand, are marine animals belonging to the phylum Cnidaria. They have a cylindrical body with tentacles surrounding their mouth. When a sea anemone is fragmented, each piece can regenerate into a complete individual. The process involves the differentiation of cells within the fragments, leading to the development of new tentacles, body parts, and eventually a mature sea anemone.
Both sponges and sea anemones have remarkable regenerative abilities, allowing them to reproduce through fragmentation. This form of asexual reproduction enables them to colonize new areas, expand their population, and adapt to changing environmental conditions. Therefore the correct option is D
Know more about Sea anemones here:
https://brainly.com/question/9933861
#SPJ8
The Question was Incomplete, Find the full content below :
The organisms which can reproduce by fragmentation are:
(a) Corals and Sponges
(b) Corals and Spirogyra
(c) Sea anemone and Spirogyra
(d) Sponges and Sea anemones.
A stream or river that runs into another stream or river is called a
Answer:
tributary
Explanation:
A tributary is a river that runs into another river.
Label the components of the initiation step of protein synthesis. Drag the appropriate labyis to their respective targets.
The process of bringing together an 80S ribosome with a messenger RNA (mRNA) and initiator methionyl-transfer RNA is known as protein synthesis initiation (Met-tRNAi)
A ribosome first travels down mRNA until it hits the Start Codon (AUG). The mRNA then binds to the Start Codon (AUG), prompting a tRNA molecule containing an amino acid (methionine) to enter the ribosome and match up, so initiating the protein-building process. This is utilized during the initial stages of TransLation.
Transcription is the initial step in protein synthesis, which involves the unfolding of DNA and the formation of a messenger-RNA (mRNA) strand. tRNA and mRNA interact in the second step of protein synthesis, translation, to code amino acids into expanding polypeptide chains.
Learn more about to protein synthesis visit here;
https://brainly.com/question/29765585
#SPJ4
explain why a viral infection can't be treated with antibiotics
Antibiotics take their effect on bacteria, precisely on their metabolism. To understand why they work on bacteria but not on viruses you must first understand the basics of how each parasite behaves, is structured and, affects the infected individual. Bacteria use ribosomes to synthesize proteins some antibiotics inhibit protein synthesis, therefore the bacteria is killed. Bacteria can evolve into becoming resistant to antibiotics by synthesizing an inactivator enzyme that cancels the effect of the antibiotic. Most bacteria affect people by releasing toxins. Viruses don't have a metabolism, one of the main reasons why they're not considered living things. They use the guest to replicate by inserting their genetic material DNA(adenoviruses) or RNA(riboviruses) inside the cell. They use the cell to multiply. Viruses are made of the mentioned genetic material(RNA or DNA) and a capsid(a capsule that encloses the genetic material). It affects the sick person by multiplying inside cells so many times, eventually making them burst, releasing thousands of viruses and, by causing an immune reaction.
To summarize antibiotics work on bacteria and not on viruses because bacteria have a metabolism that can be inhibited and viruses don't.
What was the main idea of Wegener's continental drift theory? (1
Earth's surface is composed of moving plates.
O All land masses on Earth's surface are stationary.
Land masses will eventually be replaced by ocean.
Land masses move across Earth's surface over time.
The main idea of Wegener's continental drift theory is that the Earth's surface is composed of moving plates. Thus, the correct option for this question is A.
What is Wegener's continental drift theory?Wegener's continental drift theory may be defined as the process of gradual and continuous movement of the Earth's continents relative to each other due to the trembling of tectonic plates.
He introduced the idea of moving continents that significantly breaks up in order to form several different continents. According to him, initially, there was a single continental mass that is called a Supercontinent.
With respect to time, this supercontinent is being split into other small continents through the movement of tectonic plates. The theory of continental drift states that the continents were once joined together in one large landmass.
Therefore, the Earth's surface is composed of moving plates was one of the main ideas of Wegener's continental drift theory. Thus, the correct option for this question is A.
To learn more about Wegener's continental drift theory, refer to the link:
https://brainly.com/question/9537480
#SPJ2
An organism gets food, water, shelter, and other things it needs to live, grow, and reproduce from itsa. populationb. habitatc. abiotic factorsd. species
The answer to this question is letter b. habitat. It is where the organism lives and meets all the environmental factors that they need in order to survie.
Which of the following is not part of the translation initiation complex?
mRNA
Small ribosomal subunit
Initiator tRNA
TATA box
Large ribosomal subunit
Tata box is not a part of any translation initiation complex. Option (d).
A genetic sequence's read-and-decode location is indicated by a DNA sequence called a TATA box. It is a particular kind of promoter sequence that indicates to other molecules the start of transcription. A DNA sequence is converted into an RNA molecule through the process of transcription. DNA is not directly involved in the process of translation. Eukaryotic initiation factors (eIFs) assemble initiator tRNA, 40S, and 60S ribosomal subunits into an 80S ribosome at the start codon of mRNA in a complex process known as translation initiation.
Initiation, elongation, and termination are the three phases of an mRNA molecule's translation by the ribosome. mRNA, ribosomes, transfer RNA (tRNA), and numerous enzymatic factors are essential for translation. mRNA: mRNA contains the sequence data needed to make the protein. Each codon in mRNA, which consists of three nucleotides, codes for a certain amino acid.
To learn more about Tata box visit : brainly.com/question/21777575
#SPJ4
Correct Question :
Which of the following is not part of the translation initiation complex?
a. mRNA
b. Small ribosomal subunit
c. Initiator tRNA
d. TATA box
e. Large ribosomal subunit
Is a decomposer a predator or a prey? Explain
Answer:
Decomposers are prey.
Explanation:
Decomposers break down (hence, 'decompose') dead organisms, and are heterotrophs, but are not predators. They do not actively go hunting, nor consume food like a predator typically would, and are not technically scavengers.
However, they are eaten. We eat mushrooms and fungi all the time. Other animals eat them. This constitutes them as prey.
Which statement describes how humans can decrease an ecosystem's ability to support life?
A. People cut down the trees in a forest, leaving less habitat for squirrels.
B. People build and put up bird houses, giving bluebirds needed nesting space.
O C. People allow small fires to burn in a grassland, returning nutrients to the soil.
D. People remove non-native species from a lake, allowing other plants to grow.
Answer:
A. People cut down the trees in a forest, leaving less habitat for squirrels.
Explanation:
A large percentage of the depletion of an ecosystem can be attributed to anthropogenic or human activities. Ecosystems are naturally known to support or inhabit life. For example, many trees in an ecosystem are homes to living organisms such as birds, insects, snakes etc.
However, according to this question, an exemplary description of how humans can decrease an ecosystem's ability to support life is when "people cut down the trees in a forest, leaving less habitat for squirrels". This act will decrease the forest's ability to support life.
which roles are played by calcium ions in coordinating the activation of a muscle by motor neurons?
A. Calcium ions are released from the sarcoplasmic reticulum and bind with troponin to open actin binding sites for myosin, leading to force generation.
C. Calcium ions enter the motor neuron axon terminus to stimulate vesicle fusion and neurotransmitter release into the neuromuscular synapse.
D. Calcium ions are actively pumped into the sarcoplasmic reticulum to cause muscle relaxation by allowing tropomyosin to block actin binding sites.
Calcium diffusion inside the cytoplasm between myosin and actin filaments of the muscle fibrils end up the filaments to slide into each other, and contraction of the entire muscle fiber. They also plays an important role in signal transduction pathways, in neurotransmitter release from neurons, in contraction of all muscle cell .
To learn more about Calcium ions , here
brainly.com/question/19865131
#SPJ4
The above question is incomplete
which roles are played by calcium ions in coordinating the activation of a muscle by motor neurons?
A. Calcium ions are released from the sarcoplasmic reticulum and bind with troponin to open actin binding sites for myosin, leading to force generation.
B. Calcium ions enter the motor endplate of the muscle fiber, causing depolarization of the muscle cell.
C. Calcium ions enter the motor neuron axon terminus to stimulate vesicle fusion and neurotransmitter release into the neuromuscular synapse.
D. Calcium ions are actively pumped into the sarcoplasmic reticulum to cause muscle relaxation by allowing tropomyosin to block actin binding sites.
E. Calcium ions diffuse into the sarcoplasmic reticulum to open actin binding sites for myosin, leading to force generation.
WITHOUT FURTHER ACTION TO PROTECT CORAL REEFS FROM THE
EFFECTS OF CLIMATE CHANGE AND OTHER ENVIRONMENTAL
THREATS, THE WORLD WILDLIFE FUND PROJECTS HOW MUCH OF
THE REEFS WOULD BE LOST BY 2033?
35%
25%
50%
60%
Answer:
I will say 60% or it can also be 25% lost
If anyone answers this ill give you 10,000 points guaranteed
A population of 137 prairie dogs have taken up home in a school football field! The area of a football field is 7140 m2 (1.8 acres). What is the population density of prairie dogs in the football field in m2 and acres?
Explanation:
no need for the 10k points, it was really easy!
2x + 3y = 34 y = 5x The solution is
The solution of the above simultaneous equation is x= 2, y = 10.
How to solve a mathematical equation?A simultaneous equation in mathematics is a finite set of equations whose common solutions are sought.
According to this question, two algebraic equations are given as follows:
2x + 3y = 34 ........eqn 1
y = 5x ......... eqn 2
First, we substitute 'y' in equation 2 into equation 1 as follows:
2x + 3(5x) = 34
2x + 15x = 34
17x = 34
x = 2
Since y = 5x, y = 5(2) = 10
Therefore, variable x = 2, while y = 10.
Learn more about simultaneous equation at: https://brainly.com/question/15165519
#SPJ1
Please help I will mark brainiest
The elements that are made in an average main-sequence star are helium, carbon, and oxygen.
The elements that are made in a massive main sequence star as it starts to die elements are gold and uranium,
What is the life cycle of a star?The life cycle of a star refers to the cycles which a star undergoes from birth to death of the star.
A star changes over time through a process called stellar evolution. The lifespan of a star can vary depending on its mass, from a few million years for the most massive to trillions of years for the least massive, which is much longer than the universe has been around for now.
Learn more about the life cycle of a star at: https://brainly.com/question/2386484
#SPJ1
What end must first be removed from each molecule
in order for adenine and ribose to fit together?
Which action is a response to external stimuli?drinking when thirstyeating when hungrybreathing hard when exercising because of a drop in oxygen levelswearing sunglasses to protect eyes from UV rays
wearing sunglasses to protect eyes from UV ray is reasponse to an external stimuli.
the UV rays from the sun are the external stimuli, while the oter option are internal stimuli
Identify one misconception about the theory of evolution.
Using natural selection, evolution is the process by which a species' characteristics change over several generations. The three constraints of Darwin's hypothesis concern the beginning of DNA, the unchangeable intricacy of the cell, and the lack of momentary species.
When a species splits into multiple new forms as a result of a shift in the environment that opens up new resources or introduces new environmental obstacles. Darwin's finches on the Galapagos Islands have created different molded snouts to exploit the various types of food accessible on various islands.
Learn more about evolution, here:
https://brainly.com/question/31440734
#SPJ1
Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.
Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.
Methionine can be abbreviated as Met.
The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.
We can use the codon chart to determine the amino acid sequence.
The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.
Each codon codes for a different amino acid.
For example, the codon AUG codes for the amino acid methionine.
To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).
Then we write down the amino acid sequence for the codons we read, using the codon chart.
Here, the sequence starts with AUG, which codes for methionine.
After that, the next codon is UAA which is a stop codon, so we can stop.
The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).
For more such questions on Methionine
https://brainly.com/question/29481268
#SPJ8
Give a basic definition of evolution as taught in this unit 2 Lesson 2.16. In 10th grade. Please write in your own words. Will Mark Brainliest.
Answer:
In biology, evolution is the change in the characteristics of a species over several generations and relies on the process of natural selection. The theory of evolution is based on the idea that all species? are related and gradually change over time.
What amino acid form during translation from the mRNA code UUC?
A. leucine
B. serine
C. cysteine
D. phenylalanine
Answer:
phenylalanine
Explanation:
hy please make some questions from this passage please i want to ask my students thank you
Explanation:
1) Write the balanced chemical equation of photosynthesis.
2) What is the role of chlorophyll in the process of photosynthesis?
3) What happens to the light energy that is absorbed by the chlorophyll?
Which provide evidence for the general theory of relativity? Check all that apply
gravitational lensing
the constancy of the speed of light
the curvature of space-time
changes in Mercury's orbital path
O gravitational redshift
Answer:
Gravitational redshift
Explanation:
Gravitational redshift, changes in a planet's orbital path, gravitational lensing provides concrete evidence for the general theory of relativity. Hope this is helpful and the answer you were looking for!
Answer:
1 4 5
Explanation:
Sienna decides to study movement in plants. Identify the correct sequence of the scientific steps, and place the steps in order.
She developed a
hypothesis that
plants move toward light.
Over six weeks, both
plants grew toward their
available light source.
She put one plant near
the window and another
in a dark room with a
small opening that let
light come through.
Every few days she
checked the plants
and recorded the
direction of their
growth.
1. Develop a hypothesis: Sienna hypothesized that plants move toward light. 2. Set up the experiment: Sienna placed one plant near a window and another in a dark room with a small opening that allowed light to come through. 3. Observe and record: Sienna checked the plants every few days and recorded the direction of their growth. 4. Analyze the data: Sienna examined the recorded data to determine the direction of growth for each plant over the six-week period. 5. Draw conclusions: Based on the data analysis, Sienna drew conclusions about whether the plants moved toward the available light source or not.
1. Sienna developed a hypothesis that plants move toward light. This is the initial step where she formulates her prediction based on prior knowledge or observations.
2. Sienna set up the experiment by placing one plant near a window and another in a dark room with a small opening that allowed light to come through. This step ensures that there are two distinct conditions to compare the plant growth.
3. Every few days, Sienna checked the plants and recorded the direction of their growth. This step involves making regular observations and documenting the changes in plant growth over time.
4. After six weeks, Sienna gathered all the recorded data, which included the direction of growth for each plant. This data would serve as the basis for further analysis.
5. Sienna analyzed the data by examining the recorded observations. She compared the direction of growth for each plant and looked for patterns or differences between the plant near the window and the one in the dark room.
6. Based on the data analysis, Sienna drew conclusions about whether the plants moved toward the available light source or not. This step involved interpreting the data and determining if the hypothesis was supported or refuted by the evidence gathered from the experiment.
By following this sequence of steps, Sienna was able to study movement in plants and draw conclusions about their response to light.
For more such questions on hypothesis, click on:
https://brainly.com/question/1511064
#SPJ8
How does water get underground?
A. evaporation
B. transpiration
C. percolation
Answer:C, percolation
Explanation:
took the test
3. Which of the following is not considered as right of patient / Client A. Get respectful care B. Obtain information about Treatment C. Informed consent D. Not to refuse treatment E. All
Refusing treatment is really not considered a patient's right. A patient has a right to results from the interaction care from competent personnel. A patient has a right to know his or her caregivers' names and jobs.
Which of the following are patient rights quizlet?The patient has the right to be informed about his or her health history, to participate in patient care and treatment, and to asking or refuse treatment. This right should not be interpreted as a means to force the provision of unnecessary medical or inappropriate treatment or services.
What is an illustration of a patient's right?You have such rights as a patient. Some are protected by national rules, like the right to obtain a copy of thier medical information and to keep them secret. Many states have supplemental laws that protect patients, and many healthcare facilities have a doctor bill of rights.
To know more about patient visit:
https://brainly.com/question/30474086
#SPJ1
How could an insertion error occur during DNA replication?
An insertion error during DNA replication can occur when an extra nucleotide is added to the growing DNA strand.
During DNA replication, the DNA double helix unwinds and separates into two strands. Each strand serves as a template for the synthesis of a new complementary strand. DNA polymerase, an enzyme involved in DNA replication, adds nucleotides to the growing DNA strand based on the template strand. However, sometimes errors can occur in the DNA polymerase's activity.
In the case of an insertion error, an additional nucleotide is inserted into the newly synthesized DNA strand. This can happen if the DNA polymerase mistakenly incorporates an extra nucleotide during the replication process. As a result, the DNA sequence becomes longer by one nucleotide at the specific insertion point.
These errors can disrupt the reading frame and potentially alter the protein-coding sequence, leading to changes in gene function or protein structure.
For more such answers in DNA
https://brainly.com/question/16099437
#SPJ8