The factor which does not influence is "whether or not the impulse begins in the CNS." Thus, the correct option will be E.
What is action potential?An action potential is a brief change in electrical potential that occurs when an impulse from a stimulus reaches a nerve cell. When the membrane's electrical potential changes, this causes sodium and potassium channels to open, causing the electrical charge to fluctuate.
There are a number of factors that influence the time it takes for an action potential to travel through a neuron. These factors include the length of the axon, the diameter of the axon, the presence or absence of nodes, and the presence or absence of a myelin sheath. However, the location where the impulse begins has no bearing on the time it takes for an action potential to travel through a neuron.
As a result, the correct option is E, which states that "whether or not the impulse begins in the CNS" does not influence the time required for the transmission of an action potential.
Learn more about Action potential here:
https://brainly.com/question/30701189
#SPJ11
9. The Sun provides Earth with both light and thermal energy. Which of
the following is an example of the Sun's thermal energy at work in the
water cycle?
a. Accumulation
b. Precipitation
C. Condensation
8
d. Evaporation
Answer: The answer is d!
Explanation:
If energy passes into detritus, and detritivores never use it, where might this energy end up? (A) buried as peat, coal, or oil, (B) used by primary producers, (C) used by primary consumers, (D) used by secondary consumers, (E) cycled back into the biosphere.
If energy passes into detritus, and detritivores never use it, it might end up buried as peat, coal, or oil. Option A is correct.
Detritus is composed of dead organic matter that is broken down by decomposers like bacteria and fungi. Detritivores feed on detritus, but they don't use all the energy from it.
The remaining energy can end up in the environment in different ways. In the case of detritus, if the energy is not used by detritivores or decomposers, it can accumulate in the detritus itself. Over time, detritus can become buried and compressed, eventually forming peat, coal, or oil deposits.
These deposits represent a large amount of stored energy that originated from detritus.
The other options are less likely since energy does not typically cycle back up to primary producers or consumers in a direct manner, and it is not usually transferred directly to secondary consumers without passing through primary consumers. Therefore, A is the correct option.
To know more about energy, refer here:
https://brainly.com/question/13881533#
#SPJ11
_______ is an inheritance pattern in which a trait is controlled by many genes. I WILL GIVE BRAINLIEST PLZ HELP
Which of the following are not marsupials? a. kangaroos. b. koalas. Opossums. d echidnas. Please select the best answer from the choices provided?
Answer:
echidnas
Explanation:
echidnas is not marsupials because it is a spiny insectivorous egg- laying mammal with a long snout and claws , native to Australia and New Guinea.Early during development, organisms as diverse as a human, a mouse, and a bat can appear indistinguishable. All of their embryos look nearly identical,
suggesting that
this is a coincidental resemblance between them
during development, humans go through stages of being a mouse and a bat
these very different species have a shared ancestry with all mammals
similar structures have developed because of convergent evolution
20 21 22 23 24 25 26
27 28 29
Next
18. In Hypotonic solution, the cell .. *
gets bigger
gets smaller
stays the same
The sodium-potassium pump is involved in active transport that moves 3 sodium ions from the cell for every 2 potassium ions it moves into the cell. Which of these best explains why energy is needed for active transport?.
Answer:
The sodium-potassium pump is an active transporter because it needs to move sodium and potassium ions against the concentration gradient.
Explanation:
You have to think of it as outside vs inside the cell.
Outside the cell, you have 5mM K and 150mM Na. Inside the cell, you have 100mM K and 10mM sodium. Without the transporter then the ions would go from greater concentration to lower concentration. Energy keeps the ions going from the way they would naturally happen.
A desert region would be most likely to experience what type of weathering?
A. Sedimentary
B. Exfoliation
C. Freeze-thaw
D. Biological
Answer:
The answer will be A
Sedimantary
Regulating the Cell Cvele
READING TOOL Make Connections In the graphic organizer below, fill in each box with headings from this unit to help you understand the concepts.
A cell cycle is the sequence of events that occur in a cell as it develops and splits. A cell spends the majority of its time in what is known as interphase, where it develops, copies its chromosomes, and prepares for cell division.
What is the cell cycle ?The cell cycle, also known as the cell-division cycle, is the sequence of events that occurs in a cell that causes it to split into two offspring cells. These events include the reproduction of its DNA and some of its organelles, followed by the split of its cytoplasm, chromosomes, and other components into two daughter cells in a process known as cell division.
The cell cycle in nucleated cells (eukaryotes, which include mammal, plant, fungal, and protist cells) is split into two stages: interphase and the mitotic (M) phase (including mitosis and cytokinesis).
Learn more about cell cycle
https://brainly.com/question/15876101
#SPJ1
Interferons, complement, lysozyme, and lactoferrin are all examples of A. specific antimicrobial factors. B. immune enzymes. C. nonspecific antimicrobial factors. D. cytokines.
Interferons, complement, lysozyme, and lactoferrin are all examples of C) nonspecific antimicrobial factors.
Nonspecific antimicrobial factors are components of the innate immune system that provide a broad defense against various pathogens. They are not specific to a particular microbe but act as general defense mechanisms. Interferons are proteins that interfere with viral replication and help limit the spread of viruses. Complement is a group of proteins that enhance the immune response by facilitating phagocytosis, promoting inflammation, and directly killing pathogens. Lysozyme is an enzyme that can break down the cell walls of bacteria. Lactoferrin is a protein that sequesters iron, limiting its availability for bacterial growth.
In summary, these examples all belong to the category of nonspecific antimicrobial factors, which serve as the first line of defense against a wide range of pathogens in the innate immune response.
To learn more about nonspecific antimicrobial factors click here :brainly.com/question/28214712
#SPJ11
Each body cell present in you now has different sets of genes.
False or True
Answer:
True
Explanation:
Every cell has got different sets of genes. Although they do have the same exact DNA. The set of genes expressed in a cell determines the set of proteins and functional RNAs it contains, giving it its unique properties.
1. The body’s cells require oxygen for cellular respiration. They must also rid themselves of carbon dioxide, a waste product. How does this explain the change in breathing rate? 2. The cardiovascular system moves blood around the body. Blood carries oxygen to cells and removes carbon dioxide from them. How does this explain the change in heart rate? 3. What are some of the ways your body regulates body temperature during strenuous activity? 4. How did your body respond after you stopped exercising? a. What does this response tell you about your body’s ability to maintain homeostasis? Use data from each of the 5 parameters to support your answer. 5. Research the physiology of common cold and fever. Predict the effect of common cold and fever on the five parameters.
Explanation:
1. Usually a change in breathing rate occurs when the body is undergoing an increase in body activity such as when one running or exercising. At such a point of running, for example, the body increases the levels of oxygen for the increased cellular respiration.
2. Using the same example of someone who is running, at such point, medical professionals believe that the heart which is part of the cardiovascular system begins to increase the frequency at which blood is circulated around the body. Thus, resulting in a change in heart rate (or change in the number of pumps per sec).
3. The following are a few ways:
increase in sweat glands functions which brings out water from tiny holes in our skin to cool us off.increase in heart rate; pumping more blood into the body which helps in regulating body the temperature.4. After you stopped exercising usually this occurs:
the pumping rate of the heart reducesincrease in muscle and body strengthThis almost instant response tells us that our body has an automated ability to maintain internal body temperature (homeostasis).
Why does ice have the lowest density?
Answer:
Ice actually has a very different structure than liquid water, in that the molecules align themselves in a regular lattice rather than more randomly as in the liquid form. It happens that the lattice arrangement allows water molecules to be more spread out than in a liquid, and, thus, ice is less dense than water.
pls pls help what does this have to do w science ldk but pls help lol thanks :)
Answer:
Screw on the right with closer thread
Explanation:
The more thread of the screw, the stronger it can hold the screw in place.
Neurotransmitters can be blocked which
disrupts the __ impulse from traveling
through the target neuron.
A. synthetic
B. electrical
C. somatic
D. chemical
The image below represents two waves X and Y, traveling to the same medium at the same speed how are the two waves different?
Answer: D is right
Explanation: It seems both waves have same wavelength.
Because speed = wavelength · frequency (v = λf) and
f = v/λ, so frequency is same. Because period T = 1/ frequency, also periods are same. Wave Y has higher amplidude and its energy is greater.
Answer:
D
Explanation:
just had it on study island
HELP PLEASE DUE RIGHT NOW !!!!
Answer:
D
Explanation:
Gene expression is a regulated process
If one strand of DNA has the sequence 3' TAGCATCTAC 5', the sequence of the bases on the complementary strand of DNA would be 5'______3'.
If strand of DNA has the sequence 3' TAGCATCTAC 5', the sequence of on the complementary strand of DNA would be 5'-3'.
Complementary base pairs check with the nitrogenous bases adenine, thymine, cytosine, and guanine. in a double strand of DNA, adenine will usually pair with its supplement thymine and cytosine will usually pair with its supplement guanine.
Elongation of the DNA strand usually proceeds withinside the 5'→ 3' route. This manner new nucleotides are delivered to the 3' cease of the developing strand. So, the collection of the complimentary strand in 5' to 3' route is 5'- GCATGCATGCATGCATGCATGCATGCAT− 3'.
Read more about DNA :
https://brainly.com/question/16099437
#SPJ4
how do stem and leaf plots have relative frequency distribution?
A stem and leaf plot is a type of graph that displays data by separating the digits in each data point into two parts: the stem and the leaf. The stems are grouped together and the leaves are listed next to the corresponding stem. The relative frequency distribution can be calculated by dividing the number of times each value occurs by the total number of values.
Stem and leaf plots are used to display data in a way that makes it easier to understand and interpret the distribution of the data. The data is separated into two parts: the stem and the leaf. The stem is the first part of each data point and the leaf is the second part.
For example, consider the data set {12, 15, 17, 20, 22, 25, 27}. To create a stem and leaf plot, we first divide each data point into two parts. The stem is the first digit, and the leaf is the second digit. So, the stem and leaf parts of the data set are as follows:
1 | 2
1 | 5
1 | 7
2 | 0
2 | 2
2 | 5
2 | 7
In a stem and leaf plot, the stems are grouped together and the leaves are listed next to the corresponding stem. The final stem and leaf plot will look like this:
1 | 2 5 7
2 | 0 2 5 7
From a stem and leaf plot, we can calculate the relative frequency distribution of the data set. The relative frequency distribution is a measure of how often each value occurs in the data set. To calculate the relative frequency distribution, we divide the number of times each value occurs by the total number of values. For example, if the value 15 occurs 2 times, then its relative frequency is 2/7 = 0.2857.
To know more about stem and leaf plot here:
https://brainly.com/question/12857419#
#SPJ11
15. Analyze the graph below and use numerical evidence to support the claim, the
depth of the ocean affects the amount of carbon in the ocean.
Use the following sentence stems and the evidence rubric to guide your writing.
(independent variable).
(increases/decreases) then the
(increases/decreases/stays the same).
If the.
(dependent variable).
For example...(include 2 data points from the graph!).
Amount of Carbon (ppm)
2500
2400
2300
2200
2100
2000
1900
1800
0
Amount of Carbon in the Ocean
1000
2000
3000
Depth (m)
4000
5000
Answer:
If the depth increases then the amount of carbon increases. For example, the amount of carbon found in 0 meter depth is 2000 ppm, but increases to 2200 ppm at a depth of 1000 meters.
~
Learn more about graphs, here:
https://brainly.com/question/30519536
Answer:
Explanation:
Carbon content increases with depth. For example, the carbon content found at 0 m depth is 2000 ppm, but increases to 2200 ppm at 1000 m depth.
T/F: when researching online, as long as the gathered information is the result of a valid internet search engine, it is not necessary to analyze it for bias.
When researching online, as long as the gathered information is the result of a valid internet search engine, it is not necessary to analyze it for bias.
The given statement is False.
A person can get information on what seems like an infinite number of topics by browsing the Internet, much like you would peruse the bookshelves of a library. In addition, a lot of libraries include online catalogs that can help researchers find printed books, official papers, and other materials.
Due to its accessibility to a variety of information, ease of collaboration and communication among researchers, and availability of online research tools, the Internet is a valuable research tool. Common search engines are used by people to locate books, currency conversions, definitions, file formats, news, local information, and a wide variety of other things.
Learn more about Internet:
https://brainly.com/question/32112472
#SPJ4
Why are meerkats affected by the plant population?
Answer:
They largely depend on it for survival as meerkats are omnivores.
Explanation:
The combined effects of hotter and drier summers and fewer plants would threaten the persistence of the meerkat population. Since they eat plants and other living bugs that usually hang out in plant-abundant areas, their [meerkats] survival depends on the range of plants near them.
What was it called when slaves were taken from Africa?
The transatlantic slave trade, also known as the Triangular Trade, was the name given to the historical practice of forcibly transporting millions of African people to the Americas as slaves.
What are Slaves?
Slaves are people who are owned by another person and forced to work without pay. Slaves have no rights and are treated as property, and they cannot leave their master’s control unless they are freed. Slavery has been practiced in many cultures throughout history and is still practiced in some parts of the world today.
Transport of enslaved Africans, primarily to the Americas, by slave traders is known as the Atlantic slave trade, transatlantic slave trade, or Euro-American slave trade. From the 16th to the 19th centuries, the triangular trade route and its Middle Passage were frequently used in the slave trade.
What is the Transatlantic slave trade?
The Transatlantic slave trade was the forced transportation of millions of Africans to the Americas between the 16th and 19th centuries. The slaves were forcibly taken from their homes in Africa and sold to European colonists, who then put them to work on plantations in the Caribbean, the Americas, and other parts of the world. The slave trade is widely considered to be one of the most horrific periods in human history.
To know more about the transatlantic slave trade,
https://brainly.com/question/25873490
#SPJ4
The diagrams above show Earth and the Moon in different positions, as seen from above (top view). Sunlight is coming from the left, but these diagrams do not show what parts of Earth or the Moon are light or dark. Could the half of the Moon that faces Earth ever be completely dark in any of these diagrams?
A.No, the Moon is always lit by the sun.
B.Yes, always in Diagrams 2 and 3, but never in Diagram 1.
C.Yes, always in Diagram 2, but never in Diagrams 1 or 3.
D.Yes, always in Diagram 2 and sometimes in Diagrams 1 or 3..
No, the Moon is always lit by the sun.
What is the moon?
The Moon is a natural satellite of the Earth, and it is the fifth largest moon in the solar system. It is believed to have formed around 4.5 billion years ago, shortly after the formation of the solar system.The Moon has a diameter of about 3,474 kilometers (2,159 miles), which is about one-quarter the size of the Earth. It is the largest natural satellite relative to its host planet in the solar system. The Moon's surface is covered by craters, mountains, and plains, and it has no atmosphere, water, or magnetic field.The Moon is thought to have a significant impact on the Earth's tides, as its gravitational pull causes the oceans to rise and fall twice a day. The Moon also has a significant influence on the Earth's axial tilt, which affects the planet's climate and seasons.To know more about moon, click the link given below:
https://brainly.com/question/13538936
#SPJ1
What idea did Francis Redi's experiment with the meat and maggots disprove?
*
a. biogenesis
b. spontaneous generation
c. endosymbiosis
d. primordial soup
Answer:b
Explanation:
In the sealed jars, no flies, maggots, nor eggs could enter, thus none were seen in those jars. Maggots arose only where flies were able to lay eggs. This experiment disproved the idea of spontaneous generation for larger organisms.
using the 1 hour analogy when did prokaryotes originate
the 1-hour analogy for the Earth's history, prokaryotes originated around the 10-minute mark. In biology, prokaryotes are simple, single-celled organisms without a nucleus or membrane-bound organelles, and they first appeared approximately 3.5 billion years agoIn terms of the 1 hour analogy
it is estimated that prokaryotes originated about 45 minutes into the hour. This estimate is based on evidence from the field of biology, including the fossil record and genetic analysis of living organisms. Prokaryotes are considered to be some of the earliest forms of life on Earth, with evidence of their existence dating back over 3.5 billion years. They are single-celled organisms that lack a distinct nucleus and other membrane-bound organelles.
to know more organelles please vist :-
https://brainly.com/question/3282752
#SPJ11
Prokaryotes appeared about the 10-minute point in the Earth's history, which may be compared to an hour. Prokaryotes are basic, single-celled creatures without a nucleus or organelles.
These are connected to membranes. They originally evolved around 3.5 billion years ago. Using the comparison of one hour. About 45 minutes into the hour, prokaryotes are said to have started. Based on biological data, such as the fossil record and genetic studies of living things, this estimate was made.
Prokaryotes are among the earliest known living forms on Earth, with evidence of their existence going back more than 3.5 billion years. They are monocellular creatures without a defined nucleus or any other membrane-bound organelles.
Learn more about Prokaryotes visit: brainly.com/question/13194999
#SPJ4
which two statements explain why nitrogen is important to sustaining a healthy ecosystem?
A. many of the biomolecules in living things contain nitrogen.
B. animals break down nitrogen during cellular respiration to produce energy.
C. animals need nitrogen from their surroundings in order to grow and reproduce.
D. animals can use nitrogen directly from the atmosphere.
The statements 'many of the biomolecules in living things contain nitrogen' and 'animals need nitrogen from their surroundings in order to grow and reproduce.' explain why nitrogen is important to sustaining a healthy ecosystem (Options A and C).
Why nitrogen is important for animal life?Nitrogen is fundamental in animal life because major groups of biomolecules such as proteins and DNA are composed of nitrogen. For example, in DNA, nitrogen bases composed of nitrogen are key parts of nucleotides.
Therefore, we can conclude that biomolecules contain nitrogen and animals need this element to survive in their environments (Options A and C).
Learn more about nitrogen and life here:
https://brainly.com/question/11483365
#SPJ1
Energy requiring metabolic pathways that yield complex molecules from simpler precursors are: A) amphibolic. B) anabolic. C) autotrophic. D) catabolic. E) heterotrophic
Energy requiring metabolic pathways that yield complex molecules from simpler precursors are: anabolic. The correct option is (B).
Anabolic pathways are those metabolic pathways in which simple molecules are combined to form more complex molecules. These pathways require energy, usually in the form of ATP, to drive the chemical reactions that synthesize complex molecules from simpler precursors.
Anabolic pathways play an important role in building the macromolecules needed for cellular structures and functions, such as proteins, nucleic acids, and complex carbohydrates. These pathways are also involved in the storage of energy in the form of glycogen, lipids, and other complex molecules.
Examples of anabolic pathways include protein synthesis, DNA replication, and glycogen synthesis. These pathways are often linked to catabolic pathways, which break down complex molecules into simpler ones and release energy.
Together, anabolic and catabolic pathways maintain the balance of chemical reactions in the cell, allowing it to grow, divide, and carry out its functions.
To know more about "Anabolic" refer here:
https://brainly.com/question/14932822#
#SPJ11
What is physical science
Answer:
Physical science can be described as all of the following:
A branch of science (a systematic enterprise that builds and organizes knowledge in the form of testable explanations and predictions about the universe).
A branch of natural science – natural science is a major branch of science that tries to explain and predict nature's phenomena, based on empirical evidence. In natural science, hypotheses must be verified scientifically to be regarded as scientific theory. Validity, accuracy, and social mechanisms ensuring quality control, such as peer review and repeatability of findings, are amongst the criteria and methods used for this purpose. Natural science can be broken into two main branches: life science (for example biology) and physical science. Each of these branches, and all of their sub-branches, are referred to as natural sciences.
Source: https://en.wikipedia.org/wiki/Outline_of_physical_science
Hope this helps ma dude!
Exercising the option to give a waiver can mean giving up the right to informed consent. True False
Answer:
False
Explanation:
False. Exercising the option to give a waiver does not mean giving up the right to informed consent. Informed consent is the process by which individuals are provided with information about a particular activity or procedure, including potential risks and benefits, and they voluntarily give their permission to participate or undergo the procedure. Waivers, on the other hand, are legal documents that may exempt or release individuals or organizations from liability or certain obligations. While a waiver can waive certain rights or claims, it does not inherently imply giving up the right to informed consent. Informed consent is a separate and fundamental concept in fields such as medicine, research, and legal matters.