which of the following are techniques that you can use to help the reader follow your ideas? check all that apply. avoid repetition of the same word more than once. use pronouns to refer to previous nouns. use longer paragraphs. repeat a key idea by using the same expression or a similar one. place prepositions near the end of the sentence.

Answers

Answer 1

The techniques that can be used to help the reader follow your ideas are:

Avoid repetition of the same word more than once.Use pronouns to refer to previous nouns. Repeat a key idea by using the same expression or a similar onePlace prepositions near the end of the sentence.

The techniques that can be used to help the reader follow your ideas are mentioned below:

Don't repeat the same word in a sentence or in a paragraph frequently. It might cause boredom for the reader. Use pronouns to refer to previous nouns: Use pronouns such as he, she, it, etc., to refer to previous nouns. For example: John went to the market. He bought some vegetables.

Long paragraphs might make the reader tired, which may cause difficulty in understanding the concept. So, try to keep the paragraphs short and simple.

Placing prepositions near the end of the sentence helps the reader to understand the meaning of the sentence more efficiently.

To know more about reader refer to-

brainly.com/question/16391560#
#SPJ11


Related Questions

PLEASE DONT JUST TAKE MY POINTS I NEED SOMEONE ELSES PERSPECTIVE
Respond to the following in at least 3 sentences:

What is one topic you could write an informational text about? How do you know so much about this topic?.

Answers

Answer: One topic I could write an informational text about is the Solar System. I know so much about the Solar System because of what I have learned in school. The Solar System is something that fascinates me so I have also done my own research to learn more about it.

(Sorry if this doesn't help)

what does this quote mean “Half of the people lie with their lips; the other half with their tears”

Answers

The quote implies that in our society few people mask up their lies through lips whereas others emotionally lie to people by masking that they're true through their tears.

Not all people around us are good enough to be loyal and true to us. Few always play cunning and act through their faking masks to pretend to be good to us.But it is not so. Such kinds of people are in no way useful to us and cause only harm with pain and suffering to us. These kinds of people are experts in faking their evil minds into a blanket of tears and emotions.This ends up in trusting them and in the end, we would be the sufferers for a lifetime. This hidden meaning is been conveyed to us in the quote, “Half of the people lie with their lips; the other half with their tears”.

To know more about Examples facts and expert quotes that support the reason, click below:

https://brainly.com/question/27143677

The boy( play) .... cards when they)( bear) ... their father's step they immediately (hide) ...The card and ( take ) ... out the lesson books

Answers

Answer:

was playing

heared

hide

took

Answer:

played

heard

hide

took

Explanation:

all the focused words have a past-tense except the word hide. it is spelt the same in past-tense or present-tense

select all that apply. select those areas which you check when you proofread. form grammar punctuation spelling sentence variety

Answers

When you proofread, you must check the following areas: punctuation, spelling, grammar, and sentence variety. A proofread document can help you avoid any form of embarrassing errors, including misspellings, incorrect word usage, and poor grammar.

This type of error may create a bad impression of you and negatively impact your credibility as a writer. Punctuation: When proofreading your work, always check your punctuation. You need to ensure that all punctuation is used correctly. Spelling: Check your spelling thoroughly. Any misspelled words can weaken your work and make you appear unprofessional. Grammar: Proper grammar is a critical aspect of any writing, so when proofreading, ensure your work meets the required grammar standards.Sentence Variety: Always ensure that your sentences are varied. You should have a good combination of long and short sentences, simple and complex sentences. A balance in sentence variety can improve the readability of your work.

To know more about proofreading

https://brainly.com/question/5175947

#SPJ11

Write a poem about anything please​

Answers

Please give me brainlist, if it make you happy.

Poem:

In realms beyond this mortal plain,

Where words ignite and thoughts attain,

Let us embark on a poetic flight,

Where rhymes unfurl with elegant might.

A whisper of wind, a gentle breeze,

Stirs inspiration, as thoughts appease,

The canvas of verse, blank and bare,

Yearns for eloquence, beyond compare.

Through golden meadows, we shall tread,

Where sunlight dances, and dreams are spread,

A symphony of words, in perfect rhyme,

Unveiling tales, standing the test of time.

Oh, let us delve into the depths unknown,

Where muses dwell, their secrets sown,

And from their sacred wellspring divine,

Shall flow the verses, a poetic wine.

Each stanza a tapestry, woven with care,

In imagery and metaphor, we dare,

To paint emotions with a vibrant hue,

And conjure worlds, both old and new.

With quill in hand, our spirits soar,

Exploring realms unknown, forevermore,

The poet's heart, a vessel of light,

Crafting verses, breathing life into the night.

Through whispered verses, passions take flight,

Evoking laughter, and tears in the night,

As each line unfurls, and emotions rise,

A masterpiece emerges, before our eyes.

So let us wander through the poet's realm,

In language, both subtle and overwhelms,

And with every verse, we shall aspire,

To elevate our words, to reach higher.

For in this journey, where art and soul combine,

We find the essence, the true divine,

So let our pens dance with the prose of yore,

Creating poetry, forevermore.

In worlds of dreams, where stardust gleams,

The poet's realm unfolds its themes,

And in the vast expanse of verse we see,

A reflection of our own humanity.

Here is a poem about space, use in your own words.

In the vast expanse of the universe,

Where stars twinkle and planets traverse,

There lies a mystery beyond our reach,

A place where the laws of physics breach.

Space, the final frontier they say,

A place where time and distance sway,

A canvas painted with cosmic hues,

A playground for the celestial muse.

Here, the galaxies dance and spin,

A cosmic ballet that never ends,

Black holes lurk and supernovas shine,

A spectacle that leaves us all in awe divine.

From the Moon to Mars and beyond,

Our quest for knowledge knows no bounds,

Exploring the unknown with every step,

A journey that we will never forget.

Space, a reminder of our humble place,

A glimpse of the wonders of God's grace,

A mystery that we may never solve,

But a beauty that will always evolve.

Thanks.

Select TWO ways that Coolidge (source 2) transforms the source material (source 1).

A. She includes the explicit lesson learned from Arachne’s tale.

B. She omits Athena’s sympathy as Arachne hangs herself.

C. She demonstrates Athena’s speed and skill with the loom.

D. She displays Arachne’s arrogant and impertinent behavior.

E. She adds additional characters that change the resolution of the story for Minerva.

Answers

Answer:

A. She includes the explicit lesson learned from Arachne’s tale.  D. She displays Arachne’s arrogant and impertinent behavior.

Explanation:

When Coolidge told the story of Arachne, she made sure to include the arrogant and impertinent behavior that got Arachne to challenge the gods by saying she was better than Athena.

In the end Athena turned her into a spider and Coolidge makes sure to include the lesson learned from Athena's tale of arrogance being a punishable offence.

Do all people have the same opportunities, regardless of race/gender/economic status?

Answers

Answer:  YES

Explanation:

No because some people are (race)racist or/and prejudice (gender) some people see women as weaker and not being capable to do what men. (Economic) some people can pay to go to college bigger opportunities, higher education

Write a 3 -5 page paper analysing the film "A Beautiful Day in the Neighbourhood" under the following topics
1. Servant leadership
2. Forgiveness
3. Followership
4. Authenticity
5. Friendship
6. Legacy
7. Empowerment

Answers

1. Servant leadership-  Mr. Rogers prioritizes the comfort and development of those he serves, whether they are the subjects of his TV show or his family, by putting himself last. Fred is constantly ready to hear what people have to say and to assist them in any way he can. He never hesitates to offer assistance and prioritizes the needs of others over his own.

2. Forgiveness-  Lloyd is a jaded journalist assigned to interview Mr. Rogers for a publication named Esquire. As a result of their experiences, Lloyd sets off on a voyage of self-discovery and discovers the impact that forgiveness may have on his own life.

3. Followership- He has a loyal following because of his kindness and willingness to assist others. He sets an exemplary example and fosters a compassionate environment that inspires others to improve. His passion to help others motivates people around him to improve themselves.

4. Authenticity- By demonstrating that being sincere and truthful can foster meaningful connections, he sets a motivating example for Lloyd. Additionally, Mr. Rogers shows the value of being open about one's challenges and worries.

5. Friendship- Fred and Lloyd's friendship and mutual trust serve as an illustration of how two people can become close without being related. They assist one another at trying times by exchanging personal tales from their respective lives. This illustrates the adage that, regardless of age, ethnicity, or gender, there are no friends closer than those founded on love and understanding.

6. Legacy- Mr. Rogers’ legacy is one of kindness and hope; his mission was to instill values of love, understanding, tolerance, and empathy in the lives of others. The movie is a tribute to Mr. Rogers’ lasting effect on those he touched, demonstrating that even through the smallest act of kindness, we can create a positive impact on the world.

7. Empowerment- The story is empowering.

To know more about Mr. Rogers' click below:

brainly.com/question/14241496

#SPJ4

PLEASE SOMEONE HELP!!

Read Shakespeare's "Sonnet 130.”
My mistress' eyes are nothing like the sun;
Coral is far more red, than her lips red:
If snow be white, why then her breasts are dun;
If hairs be wires, black wires grow on her head.
I have seen roses damask'd, red and white,
But no such roses see I in her cheeks;
And in some perfumes is there more delight
Than in the breath that from my mistress reeks.
I love to hear her speak, yet well I know
That music hath a far more pleasing sound:
I grant I never saw a goddess go,—
My mistress, when she walks, treads on the ground:
And yet by heaven, I think my love as rare,
As any she belied with false compare.
What is the central idea of the second quatrain?
The speaker gives his mistress roses and perfume.
The speaker’s mistress is like a rose—beautiful and fragrant.
His mistress’s cheeks are not pink, and her breath is not sweet.
Roses do not look and smell as sweet as the speaker’s mistress.

Answers

Answer:

I am assuming the second quatrain is this

"I have seen roses damask’d, red and white,

But no such roses see I in her cheeks;

And in some perfumes is there more delight

Than in the breath that from my mistress reeks."

The second quatrain continues with comparing the speaker's lover to other beautiful objects. For example, the speaker compares her breath to perfume. " And in some perfumes is there more delight Than in the breath that from my mistress reeks." Using the word "reeks" to describe her breath proves that he does not think she is better than perfume. He also compares her to roses. Again, she does not match up to the beautiful object. When described next to "roses damask'd, red and white" the speaker says he does not see the same rose color in her cheeks. These comparisons degrade the mistress's value.

Luck is not just a matter of chance; it comes from hard work. Think carefully about this statement.

Write an essay explaining the importance and benefits of working hard.
Think about the different organizational structures you can use to develop your essay. Briefly explain which structures you will use.

please help

Answers

I can’t write a whole essay on the spot but I can help you plan:
The question specifically asks to explain the importance and benefits of working hard, so only writing about chance won’t get you the mark. And as childish as it may sound, include a variety of sentences to not get the reader bored. Like it says, think about the structures you’d like to use and if needed search them up and how to use them well.

Wish you luck and I hope someone else writes you an essay. Also how long does the essay have to be?

Work hard in both your professional and personal lives. Life will thrive if you work hard in both your professional and personal connections.

We can all put in a lot of effort to build a brighter future if we have the attention and drive. Concentration is crucial since it helps us accomplish our tasks on time and more effectively. Although it is true that hard effort is the key to success, we are driven to work hard because we want to realize our goals and succeed in the future.

The advantages of working hard are so great because they strengthen our resolve to pursue our goals and ensure that we adapt well to change.

This essay has been divided into an introduction, body, and conclusion making it a structured essay.

Learn more about the benefits of working hard here:

https://brainly.com/question/9815165

#SPJ2

here are your library card and overdue books. what term best describes the sentence? phrase interrogative inverted subordinating

Answers

Inverted term best describes the following sentence "here are your library card and overdue books."

The verb comes before the subject or the whole notion is stated in an inverted phrase. Inverted sentences can be used in writing to emphasize a point or change the way sentences are put together.

In some sentence forms, the word order must be inverted, with the verb coming before the subject. These include declarative statements that start with negative or restricting words like never, seldom, hardly ever, and not only, but also conditional clauses without an if clause.

To know more about Inverted sentence here

https://brainly.com/question/2273422

#SPJ4

Sam’s flight….. at 5pm.
A freezing
B is going to leave
C will leave

Answers

C i believe is the answer. If it’s asking for a more proper way it would be b but c sounds more straight forward

Cite examples of bias/assumptions/point of view, in particular Bradford's (European) bias related to the Native Americans. Describe key scenes and explain the bias. Cite key words (loaded language) that contribute to your proof of bias.

Answers

Answer:

Another important form of bias to consider is Bradford's tendency to portray the Plymouth Plantation as being more cooperative, organized, and monolithic than it really was. For example, Bradford portrays the settlers as being united in their religious convictions.

Explanation:

i dont know if this is right but hope it helps a little

WILL GET BRAINLYEST Which actions of Ji-Suk's best develop the theme that each generation tries to be distinct?
Select each correct answer.
Responses CHOOSE MORE THAN 1

A)She learns to speak Korean.

B)She takes violin lessons.

C)She quit her career as a lawyer to open a food truck.

D)She doesn’t force her son to learn Korean.

Answers

Answer:

C.) She quit her career as a lawyer to open a food truck.

D.) She doesn’t force her son to learn Korean.

I hope this helps! ^-^

Most people opt for a fine arts degree at a prestigious fashion school. Classes include art history, fashion history, color, sewing and tailoring, and even computer-aided design (CAD). With knowledge comes wisdom and once you gain that, you are on your way to accomplishing what you want.Choose the best synonym for the underlined word in the sentence above.a.hatedc.expensiveb.respectedd.private Please select the best answer from the choices provided

Answers

The best synonym for the underlined word "prestigious" in the sentence "Most people opt for a fine arts degree at a prestigious fashion school" is (b) respected.

This is because prestigious in this context refers to a fashion school that has a high reputation and is well-regarded in the field of fine arts.

A synonym is a word, morpheme, or phrase that means exactly or nearly the same as another word, morpheme, or phrase in a given language. For example, in the English language, the words begin, start, commence, and initiate are all synonyms of one another: they are synonymous.

The complete question:

Most people opt for a fine arts degree at a prestigious fashion school. Classes include art history, fashion history, color, sewing and tailoring, and even computer-aided design (CAD). With knowledge comes wisdom and once you gain that, you are on your way to accomplishing what you want.

Choose the best synonym for the underlined word in the sentence above

a. hated

b. respected

c. expensive

d. private

Please select the best answer from the choices provided

To learn more about synonyms, visit: https://brainly.com/question/869158

#SPJ11

Imagine you are giving a sales presentation to three groups, each consisting of Arabs, Japanese and British. How would you tailor your speech to each audience

Answers

When preparing a speech, it is important to tailor ones speech to accommodate the cultural nuances and or differences in each audience.

What are cultural nuances?

The words, phrases, and beliefs that differ between countries and regions are referred to as cultural nuance.

For example, in the United Kingdom, a biscuit is served with a cup of tea, whereas in the United States, we eat cookies.

These are the small details that distinguish each culture.

What is an audience?

The people or targeted set of persons for which a speech is intended is called the audience.

Tailoring your speech to an audience helps to win over the attention and acceptation of the audience because it shows that one is culturally sensitive.

Cultural sensitivity and awareness is crucial and it can be the difference between a speaker that is persuasive and one who is not persuasive.

Learn more about speech:
https://brainly.com/question/1513918
#SPJ1

Read the description of Elizabeth Van Lew in The Dark Game. No one in Libby Prison hospital paid much attention to this tiny, birdlike woman with a thin nose and alert blue eyes as she went about her business of visiting the hospitalized soldiers. She read to them and brought them baskets of goodies. This description best supports which thesis statement?

a. The Dark Game is written in a scientific style.

b. The Dark Game is written with formal language.

c. The author makes historical characters seem like real people.

d. The author adds technical jargon to historical events.

Answers

The description of Elizabeth Van Lew in The Dark Game best supports the thesis statement "The author makes historical characters seem like real people.

The Dark Game is a book about the Civil War-era spy ring. The book is written by Paul B. Janeczko and focuses on the daring operations of Union spies. Elizabeth Van Lew was among the most effective of these spies. Elizabeth Van Lew's appearance in Libby Prison hospital is depicted in the book. While she visits the hospitalized soldiers, she is seen as a tiny, birdlike woman with a thin nose and alert blue eyes who reads to them and brings them baskets of goodies.

Her appearance in the book helps to portray the historical characters in a realistic manner. Therefore, the description of Elizabeth Van Lew in The Dark Game best supports the thesis statement "The author makes historical characters seem like real people."Option C is the correct answer.

To learn more about Dark Game, visit here

https://brainly.com/question/28307591

#SPJ11

"DOES ANYONE COLLECT OLD EMAILS" by Peter Funt

• Write an essay in which you explain how Peter Funt builds an argument to

persuade his audience that the digital age is making it more difficult to preserve

one's memories.

- In your essay, analyze how Funt uses one or more of the features in the directions

that precede the passage (or features of your own choosing) to strengthen the

logic and persuasiveness of his argument. Be sure that your analysis focuses on

the most relevant features of the passage.
. Your essay should not explain whether you agree with Funt's claims, but rather it

should explain how Funt builds an argument to persuade his audience

Answers

Peter Funt builds an argument to persuade his audience that the digital age is making it more difficult to preserve one's memories in his article "Does Anyone Collect Old Emails?" by utilizing several persuasive devices.

Funt argues that unlike printed letters, old emails may be forgotten and lost to future generations. Funt employs logical appeal, evidence, and the rhetorical question to strengthen the persuasiveness of his argument.

Funt employs logical appeal, for instance, in his argument, he explains the inadequacies of relying on digital methods to preserve memories. He explains that digital means may easily get lost or deleted without any means of retrieval.

Peter Funt also uses evidence to support his argument. He cites research studies, where various participants reported losing digital memories. One study showed that the majority of digital photo libraries have never been printed and may be lost due to crashes or outdated technology.

Additionally, Funt uses rhetorical questions to strengthen his argument. For instance, when he asks, "who among us hasn't lost digital material?" He is using this rhetorical question to emphasize that digital means may not be an effective means of preserving memories.

In conclusion, Peter Funt builds a strong argument that the digital age is making it more difficult to preserve one's memories by using persuasive devices like logical appeal, evidence, and the rhetorical question.

For more such questions on Peter Funt, click on:

https://brainly.com/question/28757107

#SPJ8

When the emperor was divine

Where is the first place that the family stays after being forced to leave their homes? What is the biggest problem about living there?

Answers

Answer:

that they dont have any wre to go

What was happening with Buck’s feet? What was the solution? Why did this happen to Buck only?

Answers

Answer:

Buck's feet were getting hurt because his paws weren't used to the rough terrain. The solution was Francois made Buck moccasins. Later his paws hardened up and got used to the terrain. This only happened to Buck because Buck was not a husky and not used to the terrain. He was a house dog before which made him not prepared for tough work.

Explanation:

STORY NAME: Growing Up Asian in America by Kesaya E. Noda
Lines 218–239: What central piece of content does the author select for her ending? Does Noda explain the meaning of the nursemaid? If so, how?

link to storys pdf: https://pdf.ac/oua2h

Answers

The central part of the content that the author selects at the end is a Japanese folk song. Noda explains the meaning of "nursemaid" by showing that this word refers to the intersection of heaven and earth.

What is the importance of the folk song at the end of the text?Emphasize the author's Asian origins.Elevate the role of the female figure.Draw a parallel between the nursemaid, the author, and the author's mother.

At the end of the text, Noda presents a Japanese folk song, showing how much she knows, respects, and is proud of her Asian origin, even though this pride has taken time to establish itself and has been corrupted by the American view of Asians.

This song also highlights how important female figures are for this acceptance, as their role in protecting and leading the new generations is essential.

Learn more about "Growing Up Asian in America:"

https://brainly.com/question/11381272?

#SPJ1

Written communication is very important in the business world, and the best way to hone one’s written business communication skills is by practicing. This assignment gives students the opportunity to show their written communication skills in the creation of an informal, analytical report style business document while also showing that they are able to analyze and evaluate business communication issues and recommend solutions. This assessment will be used to assess student learning of SLO4: At least 70% of students will be able to identify cultural, social, and ethical issues that impact business communication at least 70% of the time. Instructions: For this assignment you will create an informal, analytical report that 1. discusses at least 5 examples of how cultural, ethical, or social issues have impacted business communication in the past and 2. includes suggestions for how each of the 5 examples could be fixed or overcome. Your examples can come from a variety of sources including news articles, personal experience, experience of friends/family members, or examples included in textbooks (for this or other classes). Within the report you need to provide an analysis of the situation that discusses what happened and why it happened as well as your suggestion for how to keep the issue from happening again. If your example is from a text or the Internet make sure to include a link to the source or include it in an appropriately formatted References page

Answers

In the business world, written communication is crucial, and the best way to improve one's written business communication skills is by practice. This assignment provides students with the opportunity to display their written communication skills in the creation of an informal, analytical report style business document while also showing that they can examine and assess business communication problems and offer solutions.

The goal of this evaluation is to assess student learning of SLO4: At least 70% of students can recognize cultural, social, and ethical issues that impact business communication at least 70% of the time. The report should include a discussion of at least five cases where cultural, ethical, or social issues have influenced business communication in the past, as well as suggestions for how each of the five examples can be repaired or overcome. The examples can come from various sources, including news articles, personal experiences, experiences of friends or family members, or examples from textbooks (for this or other classes).

Within the report, an analysis of the situation should be included, discussing what happened and why it happened, as well as suggestions for how to prevent the problem from recurring. If the example is from a text or the Internet, be sure to include a link to the source or include it in a properly formatted References page.The following are the examples of how cultural, ethical, or social issues have impacted business communication in the past:Ethical Issues: A lack of ethics and values in the workplace has been a serious issue for businesses. Ethical issues arise when companies focus solely on profits and disregard the well-being of their employees, customers, or suppliers.

Businesses may deal with these concerns by adopting a more ethical approach, providing ethics training to their employees, and establishing an ethics hotline for reporting misconduct. Cultural Issues: Businesses can experience cultural problems when they operate in different countries. Employees may be unfamiliar with the culture, customs, and language of the nation in which they are working, which may lead to misunderstandings and poor communication.

Companies should provide language and cultural instruction to their employees, or partner with a local organization to provide assistance. Social Issues: Social problems can arise in the workplace when employees engage in inappropriate behavior. Examples of this may include sexual harassment, bullying, or other kinds of discriminatory conduct. The company should develop a strict code of conduct and provide training on appropriate workplace behavior to deal with these problems.

For more such questions on communication, click on:

https://brainly.com/question/28153246

#SPJ8

For you, what was the most powerful image in the poem? What made it powerful?
What point was Hughes trying to make by using the image?
This should be a minimum of one fully developed paragraph.

Answers

The question above does not present the poem to which it refers. This makes it impossible for me to answer your questions, but I'll show you how to answer them.

To answer a question you must know that:

In a poem, images are presented using adjectives.These adjectives can describe something or someone, showing the characteristics, appearance, and composition.This description is what makes the reader create mental images, which allows him to feel and see what is being described.

In this case, a strong image is one that goes through a very detailed and thorough description. The author's objective is to allow the reader to have a strong immersion in the text and to be able to feel, touch and see what is being presented.

More information:

https://brainly.com/question/23904954?referrer=searchResults

When you are asked to write a full draft of your essay, what are you being asked to do? Write a thorough plan that contains a few of the paragraphs but not all Compose and submit your actual essay fully written in full paragraph form from start to finish. with sources used, cited, and referenced Submit an overview of your goals and topic and plans for research, with a few sources listed, depending on the specific assignment Turn in a document with the introduction written, the body mapped out in a formal outline, and the conclusion written

Answers

When you are asked to write a full draft of your essay, you are being asked to compose and submit your actual essay fully written in full paragraph form from start to finish.

This means that you should present your ideas and arguments in a coherent and organized manner, with an introduction, body paragraphs, and a conclusion.

A full draft should contain all the necessary sections of an essay, including a thesis statement, supporting evidence, analysis, and a conclusion that summarizes your main points.

It is important to ensure that your draft is well-structured, logical, and supported by credible sources. While a thorough plan and an outline are helpful in the writing process, a full draft goes beyond that by presenting the entire essay in its final form.

Additionally, it is essential to properly cite and reference any sources used in your essay to avoid plagiarism and give credit to the original authors.

For more questions on draft, click on:

https://brainly.com/question/10651662

#SPJ8

The Faults in Our Stars: What important gift did Augustus feel that Hazel had given him through his reading of AIA (An Imperial Affliction)?

Answers

Answer:

The gift that Augustus refers to is the reflection that the book proposed to him.

Explanation:

"An Imperial Affliction" is a reflective, long and detailed story, which portrays death in a realistic but subjective way and without a specific ending, but open to reflections and debates. This type of story that encourages the reader to think and reflect on his temples was very much appreciated by Augustus and he believes that this was a gift, because the reasoning leads to the understanding of things that were embedded even in our life and Augustus may have passed so when reading the book.

Remember the titans vs childrens march compare and contrast them

Answers

"Remember the Titans" and the "Children's March" are both powerful examples of stories that address issues of racial discrimination and prejudice. However, they differ in terms of their settings, historical context, and mediums of storytelling.

"Remember the Titans" is a film based on a true story, set in the early 1970s, which follows the integration of a high school football team in Virginia. It showcases the challenges faced by the team as they confront racism and strive for unity. The film explores themes of teamwork, leadership, and the power of sports to bridge divides.

On the other hand, the "Children's March" refers to a historical event that took place in 1963 in Birmingham, Alabama. It was a pivotal moment during the Civil Rights Movement when thousands of schoolchildren marched to protest segregation and racial injustice. The Children's March highlights the courage and determination of young activists who played a significant role in challenging the status quo.

In terms of storytelling medium, "Remember the Titans" is a fictional film that uses actors and a scripted narrative to depict the events, while the "Children's March" is a historical event captured through photographs, news footage, and firsthand accounts.

Both stories share the common theme of confronting racial injustice, but "Remember the Titans" focuses on the integration of a sports team, highlighting themes of unity and breaking down barriers. On the other hand, the "Children's March" showcases the bravery and resilience of young activists who stood up against systemic racism.

Overall, while "Remember the Titans" is a fictionalized account that draws inspiration from real events, the "Children's March" is a significant historical event that directly captures the determination and impact of young civil rights activists.

Learn more about "Remember the Titans" here: brainly.com/question/32166214

#SPJ11

can someone help with this?

can someone help with this?

Answers

Answer:

sorry I can't able to help you

Explanation:

\(sorry\)

have a nice day ✌️✌️

What point of view does the author represent in this part of the passage

What point of view does the author represent in this part of the passage

Answers

Answer:

3rd person omni sent

8.which type of development should dough have, when using dried fruits, nuts and cheeses?

Answers

Dry fruits would absorb a lot of the water in our dough if we added them right now, which would have an impact on the outcome. Instead, give them a 30-minute soak in warm water before putting them to the dough.

During mixing, gluten is created as a result of the various proteins in your flour. A more evolved gluten structure is typically associated with longer mixing. Although it is easy to over-mix dough to the point that the wheat chains can break, we have found that amateur bakers are more likely to under-mix their dough, which results in inadequate strength and elasticity. Without expert spiral mixers, it is very difficult to over-mix a dough. You will learn how your dough should behave at any stage of a recipe the best through experience and handling loads of dough. Add extra ingredients, like as nuts and dried fruits, to the dough very gently, at the very end of the mixing process, either by hand or with a low mixer speed. In this manner, both the additional components and the dough's gluten structure will be preserved.

Learn more about gluten here

https://brainly.com/question/16779711

#SPJ4

PLEASE HELP!

-summarize the meaning of the poem in three sentences
-list three thematic topics or three main ideas
-explain the symbolism (list the symbol,what it symbolizes, and how it connects to the theme)
- how does the imagery connect to resourcefulness


Poem to Analysis:

Beneath the earth, a hidden spring,
An endless source, a sacred thing,
A well that brings forth life and light,
And bathes the world in pure delight.

It sings a song with every drop,
A rhythm, like a beating heart,
And whispers secrets to the stones,
And stories to the wind that moans.

It feeds the roots, it greens the trees,
It quenches thirst and cools the breeze,
A treasure trove that never ends,
A giver, guide, and trusted friend.

Answers

Answer:

Summary:

The poem describes a hidden spring under the earth, which is a never-ending source of life and light. The well is a treasure trove that feeds the roots, greens the trees, cools the breeze, and quenches the thirst. It is a giver, guide, and trusted friend that bathes the world in pure delight.

Three thematic topics:

The endless cycle of life: The poem highlights the never-ending source of life that the well provides, which is necessary for the growth of trees, roots, and to quench thirst. It represents the cyclical nature of life that is continuous and never-ending.

The power of nature: The poem illustrates the power of nature that is capable of providing for all of humanity's basic needs. It shows how nature provides nourishment and life to all living things and is a giver, guide, and trusted friend.

The importance of resources: The poem highlights the importance of resources and how they play a critical role in sustaining life. The well represents an essential resource that is necessary for the growth and nourishment of all living things.

Symbolism:

The hidden spring represents an essential resource that is necessary for the growth and nourishment of all living things. The well symbolizes a giver, guide, and trusted friend that bathes the world in pure delight. The rhythm and song of every drop symbolize the cyclical nature of life that is continuous and never-ending.

Imagery:

The imagery of the hidden spring under the earth and the endless source of life and light connects to resourcefulness. It illustrates the power of nature and how it provides for all of humanity's basic needs, emphasizing the importance of resources. The imagery of the well feeds the roots, greens the trees, and quenches thirst, representing how essential resources can sustain life.

Explanation:

Other Questions
When KFC wanted to enter the Japanese market, it contacted Mitsubishi, one of Japan's largestpoultry producers. Mitsubishi provided an understanding of Japanese culture and some of the financing, while KFC provided the rest of the financing and its franchising expertise. The activities ofKFC and Mitsubishi took place in the ____ component of the task environment.(A) sociocultural(B) strategic partners(C) suppliers(D) competitors(E) economic Discuss a time in history where humans have changed society for better OR for worse. What events led up to the transformation? How did the person/people make this alteration? A slingshot sends a stone vertically upward from a height of 20 feet above a pool of water. The starting speed of the stone is 90 feet per second. Its distance in feet, d, above the water is given by the equation:d = 20 + 90+ - 16+?, where t is the time in seconds after the launch.Drag statements to the table to show what each coordinate labeled on the graph represents in this problem situation. Rectangle 40 cm long, 30 cm wide, and 20 cm high marah's organization consists of an in-house project management staff and an online network of industry professionals. based on this, she is able to conduct business in the united states, europe, and the entire asia-pacific region. marah is an example of . a.a virtual organization b.a matrix design c.an m-form design d.a u-form design Find the indefinite integral. in xer (a) e' +C : (b) Inx+C: (e) rinx-x+C: (d) rinx+r+C A B OD Find the average value of the function f(x) = 2e on the interval [-1, 1) (a) 0; (b) e-(-1; (c) (e--1)/2 : (d) e . B OD Consider a two year interest rate swap with semi annual payments. Assume a notional principal of $25 million. The swap was entered into 120 days back at a fixed rate of 6.32%. The swap has remaining life of 20 months with pay dates on 2, 8, 14, and 20 months. The term structure of spot LIBOR rates are as follows: 2 months: 6.13%, 8 months : 6.29%, 14 months: 6.53%, 20 months: 6.97%. The 180 days LIBOR at the start of the swap was 5.85%. Calculate the market value of the swap from the point of view of the party paying the floating rate and receiving the fixed rate. write a c/c program that creates a child process using the fork() system call. in your program, the parent process should take a positive integer value as user input via the command line interface. the parent process should then send the input value to the child process using the ordinary pipe. and then, the child process should print out the value received from the parent. Multiplier of S&P 500 index futures contract is $250. If you took a short position in two S&P 500 futures contracts at a price of 1,510 and closed the position when the index futures was 1,492, you incurreda loss of $9,000.a gain of $18,000.a gain of $9,000.a loss of $18,000.None of the options Which of the following metamorphic rocks could have a parent rock (protolith) of shale? Slate, Phyllite, Gneiss, Schist DF, FG, and GD are midsegments of ABC. Find the value of x FILL IN THE BLANK You _____ an HTML file to the validator, which means you transfer a copy of the document to the validation website. budgeted performance considers all of the following in relation to a benchmark: (select all that apply). windsor inc. issues 500 shares of $10 par value common stock and 100 shares of $100 par value preferred stock for a lump sum of $108,000. a. prepare the journal entry for the issuance when the market price of the common shares is $168 each and market price of the preferred is $210 each. b. prepare the journal entry for the issuance when only the market price of the common stock is known and it is $186 per share. 3 Tell whether each statement is True or False.A 20 angle and a 70 angle can becomposed into a 90 angle.b. Three 50 angles compose an anglethat measures 350.c. A 15 angle and a 60 angle composean angle that measures 75.d. Four 50 angles can be composedinto a 200 angle.True FalseTrueTrueTrue4 Look at the drawing of a hand fan at the right. TheFalseFalseFal use the race writing strategy !!! 35 points :) Suppose a researcher wishes to edit a gene of interest containing the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' . Design the customized portion of an sgRNA for this target DNA sequence: 5' CUCGUUAGGACUAGUUAGCG Read the following excerpt from A Narrative of the Life of Frederick Douglass, an autobiography. Then, answer the question that follows. I never saw my mother, to know her as such, more than four or five times in my life; and each of these times was very short in duration, and at night. She was hired by a Mr. Stewart, who lived about twelve miles from my home. She made her journeys to see me in the night, travelling the whole distance on foot, after the performance of her day's work.Which rhetorical appeal or device does Frederick Douglass use in this description of his mother? Irony, because he is saying something about his mother that is the opposite of what he means Logos, because he presents only the facts about his encounters with his mother Pathos, because he is emotional in his description of his relationship with his mother Rhetorical question, because he wants the reader to think about his mother through a questionand its not C Write about 1500 words in total, chosen from a selection of three topics offered .Topics for this assignment:Discuss the difficulty of creating a cash flow analysis and pro forma financial statement for a new Venture startup. How do you suggest coping with these issues? what role does the emergency operations center play in overall multagency coordination?