What is the longest phase in a star's life cycle?

Answers

Answer 1

Answer:

T-Tauri Phase

Explanation:

The mean temperature of the Tauri star isn't enough to support nuclear fusion at its core. The T-Tauri star lasts for about 100 million years, following which it enters the most extended phase of development – the Main sequence phase.

Answer 2
i think the same answer as well

Related Questions

where are the youngest keratinocytes in your skin found

Answers

The youngest keratinocytes in the skin are found in the basal layer of the epidermis, also known as the stratum basale or germinativum.

This layer is located at the bottom of the epidermis and is in close proximity to the dermis. The basal layer contains actively dividing cells that give rise to new keratinocytes.

As these cells divide and differentiate, they gradually move upward through the epidermis, undergoing various stages of maturation and keratinization. By the time they reach the upper layers of the epidermis, the keratinocytes have become fully mature and have lost their nuclei and other organelles, forming a tough layer of protective keratin.

Here you can learn more about keratinocytes

https://brainly.com/question/15739664#

#SPJ11  

how does meiosis lead to increased genetic variation?

Answers

Meiosis specifically produces novel genetic material combinations in each of the four daughter cells. These novel pairings are the consequence of DNA switching between linked chromosomes.

There are various ways to identify genetic variation. Observations of phenotypic variation in either quantitative (traits that vary continuously and are coded for by many genes, such as leg length in dogs) or discrete (traits that fall into discrete categories and are coded for by one or a few genes, such as white, pink, or red petal colour in particular flowers) traits can be used to determine genetic variation. [Reference required]

The procedure of protein electrophoresis can be used to examine variation at the level of enzymes in order to detect genetic variation.

Learn more about  genetic variation

https://brainly.com/question/848479

#SPJ4

Regulating the Cell Cvele
READING TOOL Make Connections In the graphic organizer below, fill in each box with headings from this unit to help you understand the concepts.

Regulating the Cell CveleREADING TOOL Make Connections In the graphic organizer below, fill in each box

Answers

A cell cycle is the sequence of events that occur in a cell as it develops and splits. A cell spends the majority of its time in what is known as interphase, where it develops, copies its chromosomes, and prepares for cell division.

What is the cell cycle ?

The cell cycle, also known as the cell-division cycle, is the sequence of events that occurs in a cell that causes it to split into two offspring cells. These events include the reproduction of its DNA and some of its organelles, followed by the split of its cytoplasm, chromosomes, and other components into two daughter cells in a process known as cell division.

The cell cycle in nucleated cells (eukaryotes, which include mammal, plant, fungal, and protist cells) is split into two stages: interphase and the mitotic (M) phase (including mitosis and cytokinesis).

Learn more about cell cycle

https://brainly.com/question/15876101

#SPJ1

Squirrels and birds feed on insects in a forest. Mild temperature and high humidity favors growth of insects.

What will be the effect of decreased humidity on the forest ecosystem?
A.
Population of insects will increase in the forest.
B.
Population of birds will increase in the forest ecosystem.
C.
Competition will increase between squirrels and birds for food.
D.
Squirrels will get more adapted to the changed environmental conditions

Answers

Answer:

competition will increase between squirrels and birds for food.

See would probably be the answer because if humidity decreases then insects will likely decrease also. Because this squirrels and birds will have it harder to find food. Hope this helps :-)

ASAP Please please Help

1.The rate of photosynthesis can be measured as the volume of oxygen released by a
plant per minute. The number of bubbles of gas released per minute from waterweed is
counted.

a.The gas collected in this experiment is not pure oxygen. Suggest a reason for this.

ASAP Please please Help 1.The rate of photosynthesis can be measured as the volume of oxygen released

Answers

Answer:

photosynthisis is the rate of reaction of the chloroplasts in the plant. the oxygen is collected from the plant and transformed to oxygen

Explanation:

hope this helps

Photosynthisis is the rate of reaction of the chloroplasts in the plant. the oxygen is collected from the plant and transformed to oxygen.

What happens during cellular function?

One of the cellular functions is making food/creating energy. Plant cells do this the best as they have chloroplasts that can turn sunlight, water, and carbon dioxide into glucose and oxygen via photosynthesis.

The relationship between the structures found in cells and functions carried out by cells related to protein formation and transport or the capture, storage, and usage of energy is known as golgi body appratus.

This glucose is then turned into usable energy when it has transported to the mitochondria where it has been turned with oxygen into carbon dioxide and ATP via cellular respiration. The ATP is taken around the cell and distributed to where it is needed via the Golgi apparatus.

Therefore, One of the cellular functions is making food/creating energy. Plant cells do this the best as they have chloroplasts.  Photosynthisis is the rate of reaction of the chloroplasts in the plant. the oxygen is collected from the plant and transformed to oxygen.

Learn more about cellular functions on:

https://brainly.com/question/26309470

#SPJ2

Complete the table below. Mitosis Meiosis Number of daughter cells produced Number of chromosomes is halved. (Yes or No) Pairing of homologous hromosomes take place. (Yes/No) The daughter cells wroduced are always kentical in terms of genetic material [Yes/No) Purpose Rook%3A Anatomy.​

Answers

Mitosis

- 2 identical daughter cells (genetically)

- diploid (full set of chromosomes)

- for growth, repair and replace (body tissues)

- one division

Meiosis

- 4 non-identical daughter cells

- haploid (half the number of chromosomes)

- results in genetic variation

- 2 divisions

- for sexual reproduction

- occurs in the formation of gametes

I added some extra information, hopefully it can be useful for you :)

Which statement is factual

Which statement is factual

Answers

A I believe should be correct

The factual statement is Asexual reproduction produces offspring that are identical to the parent. Asexual reproduction is a type of reproduction in which offspring are produced from a single parent without the fusion of gametes. Hence option A is correct.

This means that the offspring inherit all of their genes from the parent, and are therefore genetically identical to the parent.

Sexual reproduction, on the other hand, is a type of reproduction in which offspring are produced from the fusion of two gametes, one from each parent.

This means that the offspring inherit genes from both parents and are therefore not genetically identical to either parent.

Therefore, option A) Asexual reproduction produces offspring that are identical to the parent is correct.

To know more about Asexual reproduction:

https://brainly.com/question/4100787

#SPJ6

Why is dna replication described as semiconservative.

Answers

because each helix that is created contains one strand from the helix from which it was copied

Black fur(B) in guinea pigs is dominant over white fur(b). Find the probability of a white offspring in a cross: Bb x bb. ​

Answers

Answer:

50%

Explanation:

the probability of white offspring is fifty percent

beta blockers, which prevent the effects of a neurotransmitter, are considered:

Answers

Beta blockers, which prevent the effects of a neurotransmitter, are considered to be antagonist medications.

Beta blockers are medications that are used to manage high blood pressure (hypertension) and are part of a class of medications called antihypertensives. Beta blockers work by blocking the effects of the hormone adrenaline, which causes the heart to beat faster and with greater force.

When the effects of adrenaline are blocked, the heart rate slows down, and the heart doesn't have to work as hard to pump blood around the body. Neurotransmitters are chemicals that are released by nerve cells. They are responsible for sending messages between nerve cells, allowing them to communicate with each other. There are many different types of neurotransmitters, including serotonin, dopamine, and adrenaline. Beta blockers block the effects of adrenaline by preventing it from binding to its receptors in the heart.

This causes the heart rate to slow down and the heart to beat less forcefully. Beta blockers also block the effects of other neurotransmitters such as norepinephrine, which is another hormone that is released by the adrenal glands in response to stress. As a result, beta blockers are often used to treat anxiety disorders and other conditions where the body produces too much adrenaline or other stress hormones.

Therefore, beta blockers which prevent the effects of a neurotransmitter are considered to be antagonist medications.

To know more about antagonist medications, visit:

https://brainly.com/question/31258309

#SPJ11

Beta blockers, which prevent the effects of a neurotransmitter, are considered antagonists.

The statement given in the question, "beta blockers, which prevent the effects of a neurotransmitter, are considered..." ends with a blank space. The given statement shows that the answer is related to the function of beta blockers and its effects on the neurotransmitter. Beta blockers: Beta-blockers are drugs that are used to treat a variety of conditions including high blood pressure, heart disease, and migraines. Beta-blockers block the effects of epinephrine (adrenaline) and norepinephrine (noradrenaline) on the sympathetic nervous system. This reduces the heart rate, blood pressure, and stress response, thereby helping to alleviate symptoms of these conditions. Neurotransmitters: Neurotransmitters are chemical messengers that are produced by nerve cells to communicate with other nerve cells. They are released into the synapse, the small gap between the nerve cells, where they bind to receptors on the surface of the next cell and transmit the signal. There are several different neurotransmitters in the brain and nervous system, each with its own specific function. Antagonists: An antagonist is a substance that blocks or counteracts the effects of another substance. In pharmacology, an antagonist is a drug that binds to a receptor and prevents the natural ligand (such as a neurotransmitter) from binding to the receptor and activating it. This effectively blocks the signal that would normally be transmitted by the receptor, thereby reducing its activity.

To know more about neurotransmitter, visit:

https://brainly.com/question/28101943

#SPJ11

Which relationship can be determined from this dichotomous key?

Answers

A dichotomous key is defined as a biological tool for identifying unknown organisms to a particular taxonomic level. It is constructed with many levels and series of couplets.

So, by observing the given dichotomous key, it is concluded that the correct answer is Option A- Organism X and Z have at least one observable trait in common in this dichotomous key.

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

Which are the reactants of photosynthesis?
A. CO2 + H2O
B. C6H12O6 + O2
C. CO2 + H2O+ ATP
D. C6H12O6+ 6O2

Answers

A. CO2+ H20

(CARBON DIOXIDE AND WATER)

How do the oceans affect the climates of the world?

Answers

Explanation:

by absorbing solar radiation and releasing heat is needed to keep making the atmospheric circulation, and by releasing aerosols influence cloud cover, by emitting the most water that falls on land as rain.

the anatomical term for a muscle cell, in skeletal and smooth muscle tissues, is

Answers

The anatomical term for a muscle cell, both in skeletal and smooth muscle tissues, is myocyte.

A myocyte is a specialized cell that makes up muscle tissue. It is also known as a muscle cell. Myocytes are responsible for the contraction of muscle tissue and generate force through the movement of proteins within the cell. They have a unique structure that enables them to perform their specialized function, including the presence of many mitochondria to provide energy for muscle contraction.

Myocytes come in different forms, including skeletal and smooth muscle cells, which differ in their structure and function. Overall, myocytes are an essential component of muscle tissue and play a crucial role in many physiological processes, including movement and circulation.

To know more about myocyte, refer here :

https://brainly.com/question/30626494#

#SPJ11


Which of the following does NOT describe the importance of the process of mitosis

Which of the following does NOT describe the importance of the process of mitosis

Answers

Answer:

Its D i think yea I thinks its d hopefully

Production of gametes from diploid cells exists the correct answer. This is not one of the functions of mitosis.

What is meant by mitosis?

Multicellular creatures depend on mitosis to produce new cells for growth and to replace damaged or worn-out cells, such as skin cells. Asexual reproduction in many single-celled organisms is mostly accomplished through the process of mitosis.

When a cell splits into two, mitosis, a type of cell division, ensures that each new daughter cell has the same genomic makeup.

During mitosis, two cells known as daughter cells are produced. The number of chromosomes must remain constant, and any newly formed daughter cells must have genetic material that is similar to that of the parent cell.

After cell division, it aids in keeping the same number of chromosomes in the daughter cells. It is in charge of the expansion and maturation of multicellular organisms. It aids in the healing of broken tissues. It aids in maintaining the right size of the cell.

Therefore, the correct answer is option a) divides the chromosomal number in half.

To learn more about mitosis refer to:

https://brainly.com/question/23750975

#SPJ2

d)Two different plants are crossed. One has the genotype tt and the other has the genotype Tt. Fill in the Punnett square below for this cross. Remember, one parent allele goes in each space on the top and side. (1 point)

e) What is the genotype ratio for this cross? (1 point)

f) What is the phenotype ratio for this cross? (1 point)

d)Two different plants are crossed. One has the genotype tt and the other has the genotype Tt. Fill in

Answers

d) The Punnett square for the cross between two plants with genotype tt and Tt is shown below:

T | t

--|--

t | Tt

t | tt

t | t

--|--

t | tt

t | tt

e) The genotype ratio for this cross is 1:1 (Tt:tt) as shown in the Punnett square.

f) The phenotype ratio for this cross is 1:1 (tall:short). All the offspring will have short stems because the tt genotype is homozygous recessive and the Tt genotype is heterozygous. The expression of the T allele masks the expression of the t allele in heterozygotes, so the offspring will all have the recessive phenotype.

The number of cells in a tumor doubles every 4.5 months. if the tumor begins with a single cell, how many cells will there be after 3 years? after 5 years?

Answers

The number of cells after 3 years will be 21,618 and the number of cells after 5 years will be 16,777,216

First, we should determine the number of months in 3 years and 5 years.

As there are 12 months in a single year

Therefore, 1 year = 12 months

So we can determine the number of months in 3 years and 5 years as follow:

3 years = 12 x 3 =36 months

5 years = 12 x 5 = 60 months.

The equation for this question can be given as:

\(2^\frac{months}{2.5}\)

For three years, the equation will be,

\(2^ \frac{36}{2.5}\) = \(2^{14.4}\)

\(2^{14.4}\) = 21, 618 cells

For five years, the equation will be,

\(2^ \frac{60}{2.5}\) = \(2^{24}\)

\(2^{24}\) = 16,777,216 cells.

Therefore, the number of cells after 3 and 5 years will be 21,618 and 16,777,216 respectively.

To learn more about cells, click here:

https://brainly.com/question/15632676

#SPJ4

1. Based on the model shown, what organisms should have the smallest population numbers in an ecosystem?
2. Based on the model, why is the producer level the largest level?

1. Based on the model shown, what organisms should have the smallest population numbers in an ecosystem?2.

Answers

In the ecosystem, at the highest trophic level there are tertiary consumers followed by secondary, primary consumers and producers.

Which organisms should have the smallest population numbers in an ecosystem?

Based on the model shown, the organisms at the highest trophic level, the tertiary consumers, should have the smallest population numbers in an ecosystem. This is because energy is lost as it flows up the food chain, so there is less energy available at higher trophic levels to support a large number of individuals.

Why is the producer level the largest level?

Based on the model, the producer level is the largest level because it forms the base of the food chain and provides the energy and nutrients for all other levels. Producers, such as plants and algae, can convert energy from the sun into organic matter through photosynthesis, which can then be consumed by primary consumers, such as herbivores. Since the energy available to support the higher trophic levels is limited by the energy available at the producer level, it is necessary for the producer level to be larger to support the rest of the ecosystem. Therefore, the larger population of producers is necessary to support the smaller populations of consumers at higher trophic levels.

To know more about ecosystem, click here

https://brainly.com/question/13979184

#SPJ1

If you are neither relaxing or contracting a specific muscle, what is happening to the amount of atp that is available in that muscle cell?.

Answers

If you are neither relaxing or contracting a specific muscle, the amount of ATP is A. staying the same or increasing.

Muscle cells require ATP as a source of energy for contraction and muscle movement. Even when you are setting your muscle to a relaxing mode, you are using some ATP to do so.

However, if a muscle is set in such a state that it is neither relaxing not contracting, hence there is no work being performed by the muscle. At this stage the ATP amount inside this muscle will remain the same and can increase if the neurons bring some extra ATP for the muscle cells to store here.

Although a part of your question is missing, you might be referring to this question:

If you are neither relaxing or contracting a specific muscle, what is happening to the amount of ATP that is available in that muscle cell?

A. It is staying the same or increasing.

B. It is decreasing rapidly.

To learn more about ATP, click here:

https://brainly.com/question/893601

#SPJ4

What is a relevant vocabulary word related to zebra mussles?

Answers

Answer: A mollusk accidentally imported from Europe. They clog pipes and water ways.

Explanation:

Answer:

A small striped freshwater mussel from NE Europe, Dreissena polymorpha. Introduced to the Great Lakes in the 1980s and deleteriously affecting water pipes, other fauna, etc.

Hope this help.

Have a good day ma'am/sir.

Be safe!

☺️☺️☺️ a biological community of interacting organisms and their physical environment.
"the marine ecosystem of the northern Gulf had suffered irreparable damage"
(in general use) a complex network or interconnected system.
"Silicon Valley's entrepreneurial ecosystem"

Answers

Answer: hmmmmmm no clue

Explanation: yeeeeeeeeeeeeeeeeeeeeeet

Cancer can be described as a disease characterized by the cell cycle going out of
control. Discuss what it means for the cell cycle to be out of control. Is it appropriate to
connect cancer and the cell cycle? Why or why not?

Answers

Answer:

-what it means for the cell cycle to be out of control: If the checkpoint mechanisms detect problems with the DNA, the cell cycle is halted, and the cell attempts to either complete DNA replication or repair the damaged DNA.

-is it appropriate to connect cancer and the cell cycle?:Superficially, the connection between the cell cycle and cancer is obvious: cell cycle machinery controls cell proliferation, and cancer is a disease of inappropriate cell proliferation. Fundamentally, all cancers permit the existence of too many cells.

Explanation:

For a population containing 70 females and 30 males, what is the effective population size, ne ?.

Answers

The effective population size would equal 84.

How do find an effective population size?

The effective population size is the size of a population that would have the same rate of heterozygosity loss as the current population.

In a population containing 70 females and 30 males, the effective population size is

4 x males x females / males + females

= 4 x 70 x 30 / 70 + 30

= 8400 / 100

= 84

The effective population size is 84.

To learn more about effective population size, refer

https://brainly.com/question/28602581

#SPJ4

Which statement best describes why the population growth rate slows as population size approaches carrying capacity?
O reproduction increases
O predation rates decrease
evolution of traits decreases
competition for resources increases

Answers

Answer:

competition for resources increases

Explanation:

When an ecosystem reaches its carrying capacity, competition for scarce resources become more intense.

The result of this is that species will either begin to die, or migrate away from the ecosystem leading to a decrease in population growth

why human cell is considered as eukaryotic cell where as bacterial cell as prokaryotic cell​

Answers

Answer:

Humans are eukaryotes. Like all other eukaryotes, human cells have a membrane-bound organelles and a definite nucleus.

Bacteria lack a membrane-bound nucleus and other internal structures and are therefore ranked among the unicellular life-forms called prokaryotes.

Explanation:

Prokaryotic cells are much smaller than eukaryotic cells, have no nucleus, and lack organelles.

il-6/stat3-dependent induction of a distinct, obesity-associated nk cell subpopulation deteriorates energy and glucose homeostasis

Answers

The induction of a distinct, obesity-associated natural killer (NK) cell subpopulation, driven by the IL-6/STAT3 signaling pathway, is found to negatively impact energy and glucose homeostasis. This discovery sheds light on the role of NK cells in obesity-related metabolic dysfunction.

The study reveals that in the context of obesity, there is an induction of a specific subpopulation of NK cells that is associated with metabolic disturbances. This induction is mediated by the IL-6/STAT3 signaling pathway, which is known to be involved in inflammation and immune responses. The activation of this pathway leads to the expansion and differentiation of NK cells, resulting in the formation of an obesity-associated NK cell subpopulation.

The presence of this distinct NK cell subpopulation in obesity is detrimental to energy and glucose homeostasis. These cells contribute to chronic low-grade inflammation and insulin resistance, which are key factors in the development of metabolic disorders such as obesity-associated diabetes.

Understanding the involvement of NK cells and the IL-6/STAT3 pathway in obesity-related metabolic dysfunction provides valuable insights into the underlying mechanisms of obesity-induced metabolic disturbances. Targeting this specific NK cell subpopulation or modulating the IL-6/STAT3 signaling pathway may hold potential therapeutic strategies for improving energy and glucose homeostasis in individuals with obesity-related metabolic disorders. Further research is needed to elucidate the precise mechanisms by which these cells impact metabolic function and to explore potential interventions to mitigate their negative effects.

Learn more about glucose:

https://brainly.com/question/13555266

#SPJ11

Which tatement BEST decribe the relationhip between adenoine diphophate (ADP and adenoine triphophate (ATP)?
©
A. With an input of energy, ADP rearrange to become ATP. B. Without any energy change, ADP rearrange to become ATP. • C. With an input of energy, ADP combine with a phophate group to become ATP. O D. With a releae of energy, ADP combine with a phophate group to become ATP

Answers

The link between adenosine diphosphate (ADP) and adenosine triphosphate (ATP) is best explained by the fact that when energy is added, ADP interacts with a phosphate group to form ATP. The right Option is (c).

The mitochondria of cells are thought of as the powerhouse since ATP is produced there. As seen in the reaction below, ATP is produced when ADP reacts with an inorganic phosphate and an energy source to generate ADP;

Pi + energy + ATP + H2O = ADP + inorganic phosphate

One adenine, one sugar, and two phosphates make up the biological molecule known as adenosine diphosphate (ADP). Its most crucial function is the creation of ATP, the most vital energy molecule in living cells, when it is coupled with a phosphate molecule. An enzyme called ATP synthase produces ATP during oxidative phosphorylation. Specifically, protons travel through the protein and cause a conformational change once a proton gradient is established. ADP and inorganic phosphate are then combined by ATP synthase to form an ATP molecule.

Learn more about adenosine triphosphate visit: brainly.com/question/897553

#SPJ4

Correct Question:

Which statement BEST describes the relationship between adenosine diphosphate (ADP) and adenosine triphosphate (ATP)?

A. With an input of energy, ADP rearranges to become ATP.

B. Without any energy change, ADP rearranges to become ATP.

C. With an input of energy, ADP combines with a phosphate group to become ATP.

D. With a release of energy, ADP combines with a phosphate group to become ATP.

Translation is the conversion between

Translation is the conversion between

Answers

Answer:

RNA and proteins

Explanation:

Hope this helps!

Bacteria account for two-thirds of _____ infections.

Answers

Bacteria account for two-thirds of tuberculosis infections in the human bodies.

Mycobacterium tuberculosis (MTB) germs are often to blame for the infectious illness tuberculosis (TB). Although it often affects the lungs, tuberculosis may also harm other bodily organs. When an infection goes undiagnosed, it is referred to as latent TB. If untreated, almost half of people with active disease—which develops from around 10% of latent infections—die. Chronic cough with blood-colored mucus, fever, night sweats, and weight loss are typical signs of active TB. Due to the disease's connection to weight loss, it was previously known as consumption. A broad variety of symptoms can result from infection in other organs.

Those who have active TB in their lungs cough, spit, talk or sneeze can transmit the disease to others through the air. Latent TB carriers do not disseminate the illness. Those who smoke and those with HIV/AIDS are more likely to be actively infected. Chest X-rays, microscopic inspection, and culture of bodily fluids are used to diagnose active TB. Blood tests or the tuberculin skin test (TST) are used to diagnose latent TB.

Learn more about Tuberculosis:

https://brainly.com/question/18173152

#SPJ4

Other Questions
According to the rational expectations model, the only time active policy has an impact on aggregate output is when Group of answer choices it is expansionary it is contractionary it is unannounced the economy has a contractionary gap the economy has an expansionary gap in the classical model, a temporary decrease in government purchases causes people to ____ their labor supply because current or future taxes are expected to ____. .A.increase; increaseB.decrease; increaseC.decrease; decreaseD.increase; decrease Select all the equations by that have the same solution as 2x-5=15 two piezometer are tapped into a pressurized pipe. the liquid in the tubes rises to a different height. what is the most probable cause of the difference in height, h between the two tubes? Is Keith a boy or girl? Select the plant cell What did the Social Gospel movement and settlement houses have in common?. Which of the following is NOT a true about atomic mass?a. The atomic mass is 12 g for magnesium.b. The atomic mass is the mass of one mole of atoms.c. The atomic mass is found by checking the periodic table.d. The atomic mass is the number of grams of an element that is numerically equal to themass in amu. kahalagahan ng ugnayan ng tao at kapaligiran sa paghubog ng kabihasnang asyano Which object has the least thermal energy?OA. 5 kg of oxygen gas at 30COB. 5 kg of liquid oxygen at -225COC. 2 kg of oxygen gas at 20COD. 2 kg of liquid oxygen at -225C A scientist named J. J. Thomson developed a model of the atom in which electrons are spread throughout a cloud of positive charge. Which discovery directly caused scientists to revise this model? With a short time remaining in the day, a delivery driver has time to make deliveries at locations among the locations remaining. How many different routes are possible?. Which period is known for olive branches, wreaths, and the cornucopia? 4. An allergen-free dessert recipe calls for the brand, Mack's Flour, but only Belle's FlourWhat should the chef do?O Use Belle's Flour, since its a good brand.O Use Belle's Flour, since it only contains wheat.Verify that Belle's Flour label contains no allergens and then use.Verify that Belle's Flour label contains only one allergen and then us Which statement below is the best explanation for why fairness norms seem to be stronger in large-scale industrial societies than in small-scale agrarian societies? a. Large-scale societies tend to embrace modern, progressive values, and fairness is one of the values that is most central to modern political thought. b.Large-scale societies were established by human subpopulations that had stronger genetic predispositions toward fairness to begin with. c. Large-scale societies generally have democratic governments, and fairness norms help ensure that this model of government functions correctly. d.Large-scale societies require that people trust in strangers for the society to function, and strong fairness norms support people in doing this What is the slope of this line? The idea that a force exists between two bodies and depends on the product of their masses and the square of the distance between them is Force's universal law of __________ the ymca, the _________________ army, and rescue missions were popular interdenominational religious organizations of the progressive era. 9. Which of these BEST describes the significance of the EmancipationProclamation?BBBH5 Analyze the impact of the Civil War on Georgia A Explain the importance of key issues andevents that led to the Civil War, include slavery, states' rights, nullification, Compromise of 1850 and theGeorgia Platform, the Dred Scott case, Abraham Lincoln's election in 1860, and the debate over secessionin GeorgiaA. It allowed slavery to remain unaltered in states who already used slave labor,B. Former slaves were afforded the right to join the war effort,C. It immediately freed the slaves throughout the country,D. It was nullified by the Congress, population groups such as sedentary older men, sedentary younger women, and active older women have a daily energy need of approximately kcalories.