What is the intermolecular attraction between a hydrogen atom bonded to a strongly electronegative?

The gas with the slowest average molecular speed at a particular temperature is chlorine, or Cl2. The right answer is 5.

The formula for the typical molecular speed is:

The atomic speed is 1/M.

Where,

The molecular mass is M.

N2 has a molecular weight of 28.01 g/mol.

F2 has a molecular weight of 37.99 g/mol.

Carbon monoxide has a molecular weight of 28.01 g/mol.

Cl2 has a molecular weight of 70.90 g/mol.

The average molecular speed decreases with increasing molecule mass. The average molecular speed increases with decreasing molecular weight.

The chlorine has the slowest average molecular speed as a result.

The substance with the slowest average molecular speed is chlorine, or Cl2. Hence option 5 is correct.

To know about average

https://brainly.com/question/12322912

#SPJ4

The presence of lone-pair electrons in a molecule can significantly affect the bond angles. This repulsion can change the bond angles between the atoms.

Lone-pair electrons are pairs of electrons that are not involved in bonding with other atoms. These electrons are found in the outermost shell of an atom and can significantly affect the shape and geometry of a molecule. When there are lone-pair electrons present in a molecule, they create a region of electron density that repels the bonding electrons.

In a molecule with no lone-pair electrons, the bond angles are determined by the repulsion between the bonding electrons. The bonding electrons are located between the nuclei of the atoms and repel each other, causing the atoms to arrange themselves in a way that minimizes the repulsion between them. This results in a predictable shape for the molecule with specific bond angles. However, when there are lone-pair electrons present in a molecule, they also create a region of electron density that repels the bonding electrons. This repulsion can significantly affect the bond angles. The repulsion between the lone-pair electrons and the bonding electrons can cause the atoms to shift their position in the molecule, leading to a change in the bond angles.

To know more about lone-pair electrons visit :-

https://brainly.com/question/8692292

#SPJ11

Answer: Organic acids form when a carboxyl group (−COOH) is substituted for one of the hydrogen atoms in a hydrocarbon.

Answer:

B)

Explanation:

it has 5

Answer:

it helps them fly (A)

Explanation:

Answer:

strengths wings?

Explanation:

If I'm right, please give brainliest?

Answer

Conditions that would favour the production of nitrogen monoxide.

1. Changing of concentration

If you add more concentration of the reactants, the forward reaction will be favoured, the reaction will shift to the right, therefore more NO will be produced, to restore the equilibrium.

2. Changing of temperature

Since this reaction is exothermic (since heat is the product), if the temperature is decreased, the reaction will shift forward, meaning it will shift to the right, this will then produce more NO.

3. Changing the volume/pressure

If we increase the volume, meaning if we decrease the pressure, the reaction will shift towards the side with more particles, the forward reaction has more particles, so the equilibrium will shift to the right and produce more NO.

We can use the ideal gas law to solve this problem:

PV = nRT

where P is the pressure, V is the volume, n is the number of moles of gas, R is the ideal gas constant, and T is the temperature in Kelvin.

Assuming that the number of moles of gas and the pressure are constant, we can write:

V/T = constant

This means that the product of volume and temperature is constant as long as the pressure and the number of moles of gas are held constant.

We can use this relationship to solve the problem.

Let V1 be the initial volume of the gas (150 cm³) and T1 be the initial temperature in Kelvin. Let V2 be the final volume of the gas (250 cm³) and T2 be the final temperature in Kelvin.

We can write:

V1/T1 = V2/T2

Solving for T2:

T2 = (V2/V1) * T1

The cubic expansitivity of gas at constant pressure is given by:

1/273K-1

We can convert the initial temperature from Celsius to Kelvin:

T1 = (0°C + 273.15) K = 273.15 K

Plugging in the values, we get:

T2 = (250 cm³ / 150 cm³) * 273.15 K

T2 = 455.25 K

Therefore, the temperature of the gas when its volume is 250 cm³ is 455.25 K (182.1°C).

Each atom contributes a single electron to the bond which involved two electrons that the atoms share.  The type of bond is double covalent bond. Hence option 4 is correct.

Covalent bond is defined as a type of chemical link where atoms share electrons to create electron pairs. These electron couples are referred to as bonding pairs or sharing pairs. Atoms create covalent bonds with one another in order to build a complete electron shell, which increases stability.

They will distribute their valence electrons equally among themselves since they have the same electronegativity. A covalent bond is a form of link between two atoms where electrons are shared equally.

Thus, each atom contributes a single electron to the bond which involved two electrons that the atoms share.  The type of bond is double covalent bond. Hence option 4 is correct.

To learn more about covalent bond, refer to the link below:

https://brainly.com/question/19382448

#SPJ1

The tendon is a whitish, fibrous tissue that is usually attached to the muscles.

The tendon is a band of connective tissue that will have a fibrous and smooth texture which is located at one end to the muscle and at the other end to the bone. This then allows that when the muscle contracts, it pulls the bone to which it is attached and then the movement of the joint is generated, this allows us to move as we move.

We can also find the tendons in other structures such as the eyeball where the muscles will generate the movement of the eye.

So the tendon will be a bridge by which the muscle can generate movement over a joint.

Therefore, we can confirm that the tendon is a whitish, fibrous tissue that is usually attached to the muscles.

To learn more about tendon visit: https://brainly.com/question/13464872

#SPJ1

The operation,  7.21 x \(10^-3\) + 2.11 x \(10^-3\) yields 9.32 x \(10^-3\) in scientific notation.

Scientific notation is used applied when dealing with very large or very small figures.

Scientific notation involves a number, multiplied by ten raised to an index.

This is an addition operation, we can carry it out as follows;

(7.21 + 2.11) x \(10^-3\) = 9.32 x \(10^-3\)

Learn more: https://brainly.com/question/18360970

The equation that represents a single replacement reaction given the various options is 2Al(s) + 6HCl -> 2AlCl₃(aq) + 3H₂O(g) (option 2)

A single replacement reaction, also known as single displacement reaction is a reaction in which elements higher in the electro-chemical series displace or replace elements lower in the electro-chemical series displace from a solution.

The following example illustrates single replacement reaction:

A + BC -> AC + B

From the above reaction, we can see that A has replace/displace B to from AC.

With the above information, we can determine the equation that represents single replacement reaction. Details below:

Equation from the questions:

From the above, we can see that only 2Al(s) + 6HCl -> 2AlCl₃(aq) + 3H₂O(g) conform to single replacement reaction.

Thus, the correct answer to the question is: 2Al(s) + 6HCl -> 2AlCl₃(aq) + 3H₂O(g) (option 2)

Learn more about single replacement reaction:

https://brainly.com/question/29662825

#SPJ1

Answer: No.

Explanation: A negative integer can only be made with 2 negative integers or 1 positive and 1 negative integer.

Answer:

4+3=3+3+2

Explanation:

4Ni(oh)3+3pb(so4)2=3pb(oh)4+2Ni2(so4)3

At a temperature of 89.9 Kelvin, 0.028900 moles of Ne in a 892.6 ml container will exert a pressure of 0.870 atm.

To answer this question, we will need to use the Ideal Gas Law equation:

PV = nRT

where P is pressure, V is volume, n is the number of moles, R is the gas constant, and T is the temperature in Kelvin.

First, we need to convert the volume to liters by dividing by 1000:

892.6 ml = 0.8926 L

Next, we can rearrange the Ideal Gas Law equation to solve for temperature:

T = PV/nR

Substituting in the given values:

T = (0.870 atm)(0.8926 L) / (0.028900 mol)(0.0821 L·atm/mol·K)

Simplifying:

T = 89.9 K

Therefore, at a temperature of 89.9 Kelvin, 0.028900 moles of Ne in a 892.6 ml container will exert a pressure of 0.870 atm.

To know more about temperature  visit

https://brainly.com/question/31425499

#SPJ11

The molecules of a solid phase have the greatest intermolecular forces, compared to their kinetic energies.

This is because solids have a much higher density than gases or liquids, which means that the molecules are more closely packed together and experience stronger intermolecular forces. At the same time, the kinetic energy of molecules in the solid phase is much lower than that of molecules in the gas or liquid phase, since the molecules are not able to move around as freely.

This results in greater intermolecular forces relative to the kinetic energy of the molecules, making the solid phase the phase with the greatest intermolecular forces compared to their kinetic energies.

Learn more about kinetic energies

https://brainly.com/question/25959744

#SPJ4

Answer:

genes

Explanation:

I passed the exam jUST trust me

Answer:

The answer is B: Genes

Explanation:

Genes is the units of information

The pillar of sustainability broken by recycling electronics in India is environmental sustainability. Implementing a law that restricts electronics recycling to the US would not necessarily be the most effective solution, as it overlooks the complex global dynamics of electronic waste management.

Recycling electronics in India often involves improper disposal methods, such as burning or dismantling without proper safety measures. This leads to environmental pollution, including the release of hazardous substances into the air, soil, and water, thus violating the principle of environmental sustainability.

However, simply mandating that electronics can only be recycled in the US may not be the most optimal solution. Electronic waste is a global issue, and restricting recycling to a single country disregards the fact that electronic products are manufactured and consumed worldwide. A more comprehensive approach to addressing electronic waste would involve international cooperation, strict regulations, and monitoring of recycling practices to ensure they meet environmental standards.

Efforts should focus on improving recycling practices globally, including promoting responsible electronic waste management, developing sustainable recycling infrastructure in multiple countries, and encouraging the adoption of safe and environmentally friendly recycling practices. This approach would foster global sustainability and address the challenges associated with electronic waste disposal more effectively than a geographically limited restriction.

To learn more about sustainability, here

https://brainly.com/question/32771548

#SPJ4

Answer:

B) The liquid solution changed color.

Explanation:

It would be B because, first of all, it makes the most sense. Also, with all the chemicals, it's most likely the liquid would change color.

Answer:

B) the liquid solution changed color

Explanation:

I did the test.

Answer:

\( ZnSO_4 + Li_2CO_3 \longrightarrow ZnCO_3 + Li_2SO_4 \)

Explanation:

Here a reaction is given to us and we need to balance the equation . The given reaction is ,

\( ZnSO_4 + Li_2CO_3 \longrightarrow ZnCO_3 + Li_2SO_4 \)

So here , we can make a table as ,

\(\begin{array}{c|c} \\ LHS & RHS \\\\ Zn = 1 & Zn = 1 \\\\ SO_4 = 1 & SO_4 =1\\\\ Li = 2 & Li= 2 \\\\ CO_3 = 1 & CO_3 = 1 \end{array}\)

We can see that the number of elements and ions is same on both LHS and RHS . Hence the reaction is already balanced .

Therefore the final reaction would be same as before that is ,

\( ZnSO_4 + Li_2CO_3 \longrightarrow ZnCO_3 + Li_2SO_4 \)

I hope this helps .

Answer:

Answer: a substance

Explanation:

A molecule is the smallest part of a substance

Answer:

Factors Affecting Solubility The solubility of a solid or a liquid solute in a solvent is affected by the temperature, while the solubility of a gaseous solute is affected by both the temperature and the pressure of the gas. We will examine the effects of temperature and pressure separately.

Explanation:

please tell me if im wrong i'll fix it asap.

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

Answer:

In the followings below, the one that doesn't attract to magnets is:

Option 4, Aluminum.

Explanation:

Mainly because of the aluminum's crystal structure.

Hope this helped you out! ^^

#CarryOnLearning

Answer:

Aluminum

Explanation:

Ferromagnetic Metals

Ferromagnetic metals and alloys are the only magnetic metals. Out of all of the elements on the periodic table, there are only 3 metals that are attracted to magnets: iron, nickel, cobalt.

Aluminum

Aluminum is a nonferrous metal (meaning not including iron or steel) that does not include any ferromagnetic metals. Additionally, aluminum itself is not magnetic, so there is no attraction between aluminum and a magnet.

Answer:

digestion and respiration

Answer:

I think the answer is: Cell

Explanation:

im not sure but i think its cell

Answer:

Explanation:

i. To find the limiting reactant, we need to compare the number of moles of each reactant that we have. We can convert the mass of Fe2O3 and CO to moles by using their molar masses.

Fe2O3: 130g / (159.69 g/mol) = 0.817 mol

CO: 50g / (28.01 g/mol) = 1.78 mol

Since we have less moles of Fe2O3 than CO, Fe2O3 is the limiting reactant.

ii. To find the mass of iron produced, we first need to find the number of moles of Fe2O3 that react by using the balanced equation.

Fe2O3: 0.817 mol Fe2O3 x (2 mol Fe/1 mol Fe2O3) = 1.634 mol Fe.

then we can convert that to mass by using the molar mass of Fe.

1.634 mol Fe x (56 g/mol) = 91.984 g of Fe

iii. To find the number of moles of unreacted reagent, we need to subtract the number of moles of Fe2O3 that reacted from the original number of moles of Fe2O3 that we had.

0.817 mol - 0.817 mol = 0 mol of Fe2O3 left over.

iv. To find the volume of CO2 produced, we need to use the ideal gas law PV = nRT.

Where P is pressure, V is volume, n is the number of moles, R is the ideal gas constant and T is the temperature in kelvin.

Since we know the number of moles of CO2 produced is 1.634 mol and pressure and temperature in the question.

So, we can calculate the volume by using this information.

V = (1.634 mol * 8.314 J/mol*K * (25+273.15) K) / 2atm = 24.24 L

So, 24.24 L of CO2 is produced at 25°C and 2atm pressure.

Answer: The kidneys help maintain the acid–base balance by excreting hydrogen ions into the urine and reabsorbing bicarbonate from the urine.

Explanation:

Radon-222 undergoes a series of three alpha (α) emissions and two beta (β) emissions during its radioactive decay process.

Radon-222, also known as Rn-222 or simply radon, is a radioactive isotope. It decays through a series of radioactive decay steps involving the emission of particles. In the case of radon-222, it undergoes three alpha (α) emissions and two beta (β) emissions.

An alpha emission involves the release of an alpha particle, which consists of two protons and two neutrons (equivalent to a helium nucleus). During each alpha emission, the radon-222 nucleus loses two protons and two neutrons, resulting in the formation of a new nucleus.

A beta emission, on the other hand, involves the release of a beta particle. There are two types of beta particles: beta-minus (β-) and beta-plus (β+). In the case of radon-222, it undergoes two beta emissions, which can either be beta-minus or beta-plus particles.

Overall, the series of three alpha emissions and two beta emissions lead to the transformation of the radon-222 nucleus into a different element through a process known as radioactive decay.

Visit here to learn more about radioactive:

brainly.com/question/1236735

#SPJ11

Answer:Main Answer:

The mass of CO2 released in the production of 123,000 g of H2 gas is 265,200 g.

Explanation: From the given equation, we can see that the production of 4 moles of H2 requires the combustion of 1 mole of CH4, resulting in the release of 2 moles of H2O and 1 mole of CO2. The molar mass of H2 is 2 g/mol, and the molar mass of CO2 is 44 g/mol. Therefore, the mass of CO2 released in the production of 123,000 g of H2 is (123,000/2) x (1/4) x 44 = 265,200 g.

The coefficients in front of each reactant and product allow us to predict how much reactants are required to form a given amount of products.

Reactants are converted to products and the process is symbolized by a chemical equation. For example  (Fe) and  (S) combine to form iron sulfide Fe(s) + S(s) → FeS(s) The plus sign indicates that iron reacts with sulfur.

Therefore, chemical equation is a mathematical expression of the chemical reaction which represents the product formation from the reactants. In an equation the reactants are written on the left-hand side and the products are written on the right-hand side demonstrated by one-headed.

Learn more about chemical equation: brainly.com/question/25769000

#SPJ1