The brain of a sheep serves as its central nervous system. It directs the movement, feeling, and mental processes of the sheep. The cerebrum, cerebellum, and brainstem are the three primary regions of the sheep brain.
The cerebrum, which makes up the majority of the sheep brain, controls consciousness, perception, and cognition. It has the left and right hemispheres, which are joined by a mass of nerve fibres known as the corpus callosum. The cerebrum is in charge of taking in and deciphering data from the senses, like sight and hearing.
Coordination and balance are controlled by the cerebellum, which is situated beneath the cerebrum. It uses data from the senses, such as the eyes and ears, to coordinate the movements of the sheep. The sheep's ability to walk and run smoothly depends on its cerebellum.
The brainstem, which sits in between the cerebrum and the spinal cord, regulates vital processes including breathing, heart rate, and blood pressure. In addition, it has circuits that link the spinal cord and the rest of the body to the sheep brain.
For more such questions on sheep brain.
https://brainly.com/question/29494636#
#SPJ11
PLZ HELP 40PTSThe table below shows the mass of some horse fossils.
Horse Fossil Record
Horse Fossil Mass (kg)
A 80
B 270
C 150
D 50
Ancient horses had less mass than present-day horses. The mass of the present-day horse is about 500 kilograms. What is the correct order of evolution of the horse starting from the youngest fossil?
1. A C D B
2.B D C A
3. D A C B
4. B C A D
Answer:
D and 4
Explanation:
Answer:
Its D and the last one is 4
Explanation:
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
Once you print, cut all the pieces apart. Then reassemble the puzzle so the the definition backs up with the card that has the term. So if one card says: double helix, the card that matches with it would say: the shape of DNA.
DNA replication is the process through which DNA duplicates. It occurs in the interphase and involves different enzymes, DNA molecules, and free nucleotides. Terms and definitions in the attached files.
What is DNA replication?
DNA replication is the process through which DNI molecule duplicates. This event takes place during the S stage of the interphase. So when the cell divides during mitosis or meiosis, each cell will get a complete set of chromosomes.
DNI replication is semi-conservative because each new molecule carries an original DNI strand and a new one. The fact that the new molecule is composed of an original strand makes it semi-conservative. The old existing strands are used to synthesize the new complementary strand.
The origin of the replication requires helicase enzymes to break hydrogen bonds and separate the two original strands. The topoisomerase enzyme is necessary to release tension. Other proteins are also needed to join the strains and keep them separated. Once the molecule is opened, there is a region named replication forks. DNA polymerase makes the new nucleotides enter into the fork and pairs them with the corresponding nucleotide of the original strand. Adenine pairs timine, and cytosine pairs guanine.
DNA strands are antiparallel, and replication occurs only in 5'-3' direction. So one of the strands will replicate continuously, while the other strain will be formed by short fragments known as Okazaki fragments.
Primers are needed to make the DNA polymerase work. Primers are small units of RNA and are placed at the beginning of each new fragment.
In the attached files you will find the terms and their definitions.
You can learn more about replication at
https://brainly.com/question/29398205
#SPJ1
An astronaut is planning a trip to a newly-discovered planet according to the law of universal gravitation, the astronaut weight in the new planet will be greater than his weight on earth if:
The new planet has more mass than Earth but the same radius. The mass of the astronaut will be calculated by the use of Newton's gravitational equation. The weight of the astronaut depends completely on its mass and the gravitational acceleration of the planet.
Gravitational acceleration is directly proportional to the mass of the planet and indirectly proportional to the radius of the planet. Hence, when the gravitational acceleration increases the planet's mass will increase therefore the radius will decrease. The astronaut's mass will depend on these factors.
Learn more about Gravitational acceleration, here
https://brainly.com/question/3009841
#SPJ1
What is photosynthesis
Answer:
Photosynthesis is the process where plants transform sunlight, water and carbon dioxide into oxygen to make a sugar which the plants need in order to survive.\(\tt{ \green{P} \orange{s} \red{y} \blue{x} \pink{c} \purple{h} \green{i} e}\)
distinguish between the following processes in the kidney: filtration, reabsorption, secretion, excretion
Filtration, reabsorption, and secretion are three mechanisms involved in the formation of urine which occur in the nephrons of kidneys.
The urinary bladder stores urine, a yellowish liquid waste, which is then expelled to the outside through the urethra. The production and elimination of urine contribute to the control of blood pressure, blood volume, blood osmolarity, blood pH, and body fluid balance.
Filtration occurs in the renal corpuscle where blood plasma components are forced through the glomerular filtration membrane which results in the formation of filtrate in the Bowman's space. As the filtrate flows through the renal tubule, water, and essential solutes are returned into the blood through the process of reabsorption while excess ions and metabolic wastes are excreted into the urine through the process of secretion.
To know more about nephrons click here:
https://brainly.com/question/29857887
#SPJ4
what do the spinal cords do?
Answer: They help regulate your nerve system.
Explanation: The spinal cord is the first thing to get in touch with your nerve cells.
What is a nerve impulse?
Answer:
A nerve impulse is the way nerve cells (neurons) communicate with one another.
Explanation:
True or False?
The eastern United States has three types of plate boundaries offshore.
Answer:
True
Explanation:
divergent, convergent, transform
Answer:
true
Explanation:
true
17. Create a Punnett square to solve the following codominance problem: In camellia flowers, petal color is controlled
by codominance. When a red (RR) is crossed with a white flower (WW), all the offspring are covered in both red and
white petals. If you cross a red flower with a red-and-white flower what is the probability of getting the following:
Represent answers as a fraction.
Red flowers:
White flowers:
Red-and-White flowers:
Answer:
A Punnett square is a grid used to predict the possible outcomes of a genetic cross. To create a Punnett square for the problem you described, we can use the following format:
R R
W RW RW
W RW RW
The letters in each box represent the genotype (the genetic makeup) of the offspring. In this case, the parents are a red flower (RR) and a red-and-white flower (RW).
The probability of getting a red flower: 1/2 or 0.5
The probability of getting a white flower: 0
The probability of getting a red-and-white flower: 1/2 or 0.5
It's important to keep in mind that this is a theoretical probability, as with any natural reproduction, there could be variations in the final outcome.
You have a water plant in a test tube. You place it outdoors. At what TIME OF DAY will
the oxygen level in the tube be the LOWEST?
The main role of calcium ions at chemical synapses is to
Select one:
a. depolarize the axon terminal of the presynaptic cell.
b. bind to neurotransmitter receptors on the postsynaptic cell
c. cause fusion of synaptic vesicles with the plasma membrane of the axon terminal.
d. interfere with IPSPs in the postsynaptic cell.
e. diffuse across the synaptic space and enter the postsynaptic cell.
The main role of calcium ions at chemical synapses is to cause fusion of synaptic vesicles with the plasma membrane of the axon terminal. This process allows for the release of neurotransmitters into the synaptic cleft, which can then bind to neurotransmitter receptors on the postsynaptic cell and depolarize it.
Without the influx of calcium ions, the release of neurotransmitters and subsequent communication between neurons would not be possible.
Chemical synapses are biological connections that allow impulses to travel from neurons to non-neuronal cells, like those in muscles or glands, as well as between neurons. In the central nervous system, circuit formation is made possible via chemical synapses between neurons. They are essential to the biological calculations underlying vision and thinking. They make it possible for the nervous system to communicate with and regulate many bodily processes.
To know more about chemical synapses click here:
https://brainly.com/question/9206844
#SPJ11
What type of cell has a cell wall made of chitin, has a nucleus, and does not have
chloroplasts.
Answer:
fungi
Explanation:
I think so but I'm not sure
Answer:
prokaryotic cell
Explanation:
they are primitive cells
Which of the following correctly identifies a difference between mitosis and meiosis?
Mitosis results in two diploid daughter cells; meiosis results in four haploid daughter cells.
Mitosis results in four diploid daughter cells; meiosis results in two haploid daughter cells.
Mitosis results in one diploid daughter cell; meiosis results in four haploid daughter cells.
Mitosis results in two diploid daughter cells; meiosis results in one haploid daughter cell.
Answer: The answer is A as mitosis will create 2 daughter cells while meiosis will create 4
Explanation:
Please mark brainliest and have a good day :D
HELP PLEASEEE
According to the law of conservation of mass, the mass of the______ in a chemical reaction must equal the mass of the______..
Answer:
1st blqnk line: Reactants
2nd blank line: Product
Example: According to the law of conservation of mass, the mass of the Reactants in a chemical reaction must equal the mass of the Product.
A mother's body undergoes many changes to accommodate the developing fetus during pregnancy. Most doctors blame this discomfort on an increase of hormones in the body. Which two organ systems contribute to increased itching and stretch marks during pregnancy?
Answer:
1. Integumentary System
2. Digestive System and Endocrine System
Explanation:
An organ system combines multiple organs to perform one or more biological functions.
The integumentary system which human skin, is an organ system that protects the outer body. So the stretch marks women experience during pregnancy are evident on the skin, and since it was mentioned in the question that "A mother's body undergoes many changes to accommodate the developing fetus during pregnancy" it can be concluded that the skin stretched due to fetus development.
The digestive system here, the liver, can get disordered by a liver disease known as Cholestasis, which alters the flow of bile produced by the liver for digestion and can lead to bilirubin buildup poisoning blood and causing itchiness that can be experienced during pregnancy.
The Endocrine system is the Hormone center of the body, it affects the mood, and can cause itchiness too.
which of the following is a form of vascular neurocognitive disorder caused by transient attacks in which blood flow to the brain is interrupted by a clogged or burst artery?
A stroke is a sudden disruption of the brain's regular blood flow that results in the loss of neurocognitive disorder function. Blockages or bleeding in the brain can cause the cessation of blood flow, which can result in the more common ischemic stroke or the more fatal hemorrhagic stroke.
Vascular. Reduced cerebral blood flow resulting from several large volume or lacunar infarcts that produce a fast start and stepwise reduction in cognitive function are the main causes of NCD, a progressive illness.
Although vascular NCDs are common and have significant clinical impact, there is still debate over their terminology. Vascular dementia is brought on by a variety of illnesses that damage the blood vessels in the brain and disrupt the delivery of oxygen and blood to the brain.
Learn more about neurocognitive disorder Visit: brainly.com/question/7304756
#SPJ4
What are the prefixes/ suffixes of the word observation?
. compare the control of gene regulation in eukaryotes and bacteria at the level of initiation of transcription. how do the regulatory mechanisms work? what are the similarities and differences in these two types of organisms in terms of the specific components of the regulatory mechanisms?
Recognition of the promoter can be affected by activators and repressors.The (omega) component of a RNA polymerase holoenzyme recognizes the promoter in bacteria.
Similarities: Cis-acting elements and trans-acting factors must interact for transcription to begin. Upstream of a transcribed gene are components called promoters that are necessary. Recognition of the promoter can be affected by activators and repressors. Although they have diverse structures, DNA loops have a role in the control of transcription initiation.
Differences: The (omega) component of a RNA polymerase holoenzyme recognizes the promoter in bacteria. The specificity of transcription is controlled by the recognition of various promoter sequences by various (omega) subunits. Additionally, RNAs (attenuators, riboswitches, and sRNAs) can either allow as well as repress initiation, making transcription adapt to environmental or cellular conditions. Repressor proteins that cause DNA conformational adjustments (repression loops) can prevent RNA polymerase from binding to the promoter. In eukaryotes, the chromatin structure may have to be altered in order to change how accessible the promoter is to the transcriptional machinery. General transcription factors attract RNAP II to promoters. Additionally, enhancers and silencers are each bound by activators and repressors, respectively. Large DNA loops may be created, putting promoters & enhancers (or silencers) near to one another, according to one theory.
Learn more about DNA
https://brainly.com/question/264225
#SPJ4
If an offspring has a recessive trait show up, such as blue eyes, what combination of alleles must be present?
Group of answer choices
1 dominant and 1 recessive gene
2 dominant genes
2 recessive genes
Answer:
2 recessive genes
Explanation:
A recessive trait can only be present in the absence of the dominant gene.
For example the gene for brown eyes are dominant and the gene for blue eyes are recessive.
**the dominant gene is usually represented with a capital letter and vice versa for the recessive*
Denoting:
B for brown eyes
b for blue eyes
We know that gametes (sex cells) have half the number of chromosomes (haploid number) than all the other cells in the body, the reason for this is because during fertilization, both male and female gametes combine and then in total they have the diploid number of chromosomes.
so for each trait, you have an allele from each the mother and father. Heterozygous means that there are two different alleles for the gene and homozygous means that both alleles for a specific gene are the same.
In the case of eye colour, any combination that has the dominant Brown allele in it results in the offspring having brown eyes no matter if there is also a recessive blue allele.
the combinations BB, Br all result in brown eyes and the only possibility of blues eyes are bb
What is the study of the forms and features of land surfaces?
Plate tectonics
Seafloor spreading
Continental drift
Topography
Answer:
Plate tectonics
Explanation:
Plate tectonics is the study of the forms and features of land surfaces.
In the Hardy-Weinberg principle, the actual number values of p and q will not change if five specific conditions are being met. This indicates
Question 1 options:
evolution is occurring only because of mutations
evolution is not occuring
evolution is occurring rapidly because of climate change
evolution is occurring because of natural selection
In the Hardy-Weinberg principle, the values of p and q will not change if evolution is not occurring.
What is the Hardy-Weinberg principle?The Hardy-Weinberg principle is a model used in population genetics to estimate genotypic and allele frequencies in a population.
The Hardy-Weinberg principle states that allele and genotypic frequencies remain constant in absence of evolutionary forces.
These evolutionary forces include nonrandom mating, gene drift, gene flow, mutation and natural selection.
Learn more about the Hardy-Weinberg principle here:
https://brainly.com/question/3406634
Why do genes only make up a small percentage of DNA?
A. We only use a small portion of DNA, because there aren't that many unique proteins.
B. It reduces the chances of genes being damaged.
C. It prevents cells from accidentally making the wrong protein.
D. The extra DNA will eventually be turned into genes as organisms evolve.
Answer:
b
Explanation:
.....................
Now, raise one of your hands just slightly and press both hands together again. This motion models a thick plate pressing against a thin one. What happens? How does this model further explain plate movement?
Beans and coal both have stored energy. Which of the following correctly identifies where the energy that is stored in beans and coal comes from?
The energy that is stored in beans and coal comes from the sun. Both beans and coal are products of photosynthesis, which is the process by which plants convert sunlight into chemical energy.
In the case of beans, this energy is stored in the form of carbohydrates, proteins, and fats, which can be used as fuel by animals and humans.
In the case of coal, this energy is stored in the form of carbon, which was formed from the remains of ancient plants and animals that lived millions of years ago. Over time, heat and pressure caused these remains to be transformed into the fossil fuel we know as coal. So while beans and coal may seem very different, they both owe their energy content to the same source: the sun.
In summary, the stored energy in beans and coal ultimately comes from the sun. However, the energy in beans comes directly from living plants that recently performed photosynthesis, while the energy in coal comes from ancient plant matter that has undergone geological transformations over millions of years.
Learn more about sun as a source of energy :
https://brainly.com/question/8646056
#SPJ11
Are seafloor spreadings the same thing as ocean basins?
Answer:
No
I hope this helps!
The number of fatty acids chains present in a molecule of a
phospholipid is _
The molecule of phospholipid contains two fatty acid molecules linked to -OH groups and a nitrogen-containing base bound to the phosphate group.
Phospholipids are a class of lipids whose molecule has a hydrophilic head containing a phosphate group and two hydrophobic tails derived from fatty acids, joined by an alcohol residue.
Thus, it has a strongly non-polar and hydrophobic tail consisting of fatty acid chains and a polar and hydrophilic head comprising a negatively charged phosphate group and a positively charged base. Because of this dual solubility, the phospholipids are called AMPHIPHATIC lipids.
learn more about phospholipids at -
brainly.com/question/12148124
2. How is the chromosome theory of inheritance related to Mendel's findings
The chromosome theory of inheritance is directly related to Mendel's findings in genetics. In Mendel's experiments with pea plants, he observed the inheritance of traits from one generation to the next. He postulated that traits were passed down in discrete units, which he called "factors" (now known as genes).
Later, scientists discovered that these genes were located on chromosomes, which are the structures that carry genetic information in cells. The chromosome theory of inheritance states that genes are located on chromosomes and are passed down from parents to offspring during reproduction. This theory is consistent with Mendel's findings and provides a mechanism for how traits are inherited from one generation to the next.
In summary, the chromosome theory of inheritance helps to explain the physical basis of Mendel's observations and provides a framework for understanding how genetic information is passed down from generation to generation.
To know more about chromosome theory click here:
https://brainly.com/question/8262302
#SPJ11
Please answer fast!
worth 100 points
Answer:
self feeder; E from sun or chemicals - autotrophs
has a nucleus & membrane-bound organelles - eukaryote (5)
the smallest taxonomic division - species (4)
no nucleus or membrane bound organelles - prokaryote (6)
one organism living inside another, both benefit - mutualism
two term - binomial (1)
Explanation:
how do organelles work together to maintain all life processes in a unicellular organism?
Answer:
Cell organelles must work together to carry out protein synthesis, utilize proteins within the cell, and transport them out of the cell.
Explanation:
To conduct out protein production, use proteins inside the cell, and transfer them out from the cell, cell organelles must collaborate.
Organelles, like organs in an organism, operate with each other to carry out the duties of the cell overall.
Mitochondria, for example, are the locations of cell respiration and supply energy to cells. The control center is the nucleus. Microbial wastes are digested and hydrolyzed by lysosomes.
Learn more:
https://brainly.com/question/15299967?referrer=searchResults