what are the events in asexual reproduction in ascomycetes? multiple choice question. asexual, flagellate spores are produced under appropriate environmental conditions. hyphae produce conidia, which grow into genetically identical hyphae. hyphae undergo meiosis to produce spores, which produce genetically identical hyphae.

The specialization of function in one hemisphere of the cerebral cortex or the other is called lateralization.

Lateralization refers to the phenomenon where the two hemispheres of the brain exhibit functional specialization, meaning that certain functions are more dominant in one hemisphere than in the other. For example, the left hemisphere is typically more involved in language processing and logical reasoning, while the right hemisphere is more involved in spatial perception and creative thinking.

Lateralization is important for our overall cognitive functioning because it allows us to process information more efficiently. By dividing up cognitive tasks between the two hemispheres, our brain is able to process information more quickly and effectively than if we relied on just one hemisphere alone. Additionally, lateralization can be influenced by environmental factors, such as learning a new language or musical instrument, which can lead to changes in the brain's structural and functional organization. Overall, lateralization is an important concept in the study of cognitive neuroscience and helps us to better understand the complex workings of the brain.

Learn more about the cerebral cortex at https://brainly.com/question/1191477

#SPJ11

Answer:

probably flood

:))

Explanation:

hehehe

Man's genotype is DdHd. Women's genotype is ddHh. 25% of the kids will have curly hair and dimples. One-quarter of all children will have straight hair and a dimple. 25% of the kids will have curly hair and no dimples.

An organism's genotype is its whole collection of genetic material. The term "genotype" can also refer to the alleles or variations that an individual possesses in a certain gene or genetic region. A genotype is a classification of the kind of variation found at a certain position (i.e., a locus) in the genome. Symbols can be used to symbolize it. For example, the letters BB, Bb, bb might be used to indicate a specific mutation of a gene. In a general sense, the term "genotype" refers to an organism's genetic composition; in other words, it characterizes an organism's whole collection of genes.

Here,

DdHd is genotype of man. ddHh is genotype of women. 25% children will have curly hair and dimple. 25% children will have straight hair and dimple. 25% children will have curly hair and no dimple.

To know more about genotype,

https://brainly.com/question/12116830

#SPJ1

Answer:

Gene flow, also called gene migration, the introduction of genetic material (by interbreeding) from one population of a species to another, thereby changing the composition of the gene pool of the receiving population. The introduction of new alleles through gene flow increases variability within the population and makes possible new combinations of traits. In humans gene flow usually comes about through the actual migration of human populations, either voluntary or forced.

To acquire a bursary, learners typically need to meet three criteria: financial need, academic achievement, and meeting specific eligibility requirements set by the bursary provider.

Meeting these three criteria increases the chances of a learner acquiring a bursary by demonstrating financial need, academic capability, and fulfilling the specific eligibility requirements set by the bursary provider.

Learn more about  bursary here: https://brainly.com/question/26951964

#SPJ11

Answer:

Materials that have not been contaminated by radioactive materials are still considered low-level waste if they have been exposed to neutron radiation.

Scavengers living in the coral reef scavengers living in the coral reef clean up algae and decayed matter. Thus, correct answer is B.

The Harlequin shrimp is a native of salt water marine environment. It is found near the coral reefs in the Pacific and Indian Oceans. It drives nutrition by eating starfish. They are very skilled in obtaining the starfish as a prey. They firstly eat the tube feet and soft tissues and then the central disk is feeded upon.

They are also called Hymenocera picta scientifically and are majorly habitats to the coral of the Pacific and the Indian oceans. They belong to the phylum Arthropoda and are invertebrates.

They are two inches in length and specifically eats starfishes. Their feeding mechanism enables the population of the starfish to be balanced as starfishes are the primary food source for them.

Therefore, Scavengers living in the coral reef scavengers living in the coral reef clean up algae and decayed matter. Thus, correct answer is B.

Learn more about Scavengers on:

https://brainly.com/question/29618120

#SPJ2

Answer:

fossils

Explanation:

The unique material formed from dense packing of neurons and glia in the cerebral cortex is called grey matter.

Grey matter is a vital component of the central nervous system, consisting mainly of neuronal cell bodies, dendrites, and unmyelinated axons. It plays a crucial role in processing information, integrating sensory inputs, and regulating muscle movements. Neurons transmit electrical signals, allowing for communication between different regions of the brain, while glial cells (astrocytes, oligodendrocytes, and microglia) provide support, protection, and nourishment to the neurons.

The cerebral cortex is the outermost layer of the brain, responsible for higher-order cognitive functions such as learning, memory, language, and decision-making. Grey matter is distributed throughout the cortex, with specific areas dedicated to distinct functions. For instance, the frontal lobes are involved in executive functions, while the temporal lobes are associated with auditory processing and memory. In summary, grey matter is the unique material in the cerebral cortex composed of densely packed neurons and glial cells, responsible for processing and integrating information to regulate various cognitive and motor functions.

Learn more about central nervous system at

https://brainly.com/question/31445984

#SPJ11

Answer:

Interphase is the longest part of the cell cycle. During Interphase, cells grow and duplicates. During Interphase, cells that are still dividing copy their DNA and prepare for cell division. Cells no longer dividing are ...

Explanation:

So sorry. I don't know the ending and I am not sure if the answers are correct.

The characteristic of water that allows the climate to remain similar throughout the year in environments located near large bodies of water is its high specific heat capacity.

Water has a unique ability to absorb and retain a large amount of heat energy without undergoing significant temperature changes. As a result, water bodies act as thermal regulators, moderating the temperature of the surrounding air and creating a more stable and consistent climate.

During the summer, water bodies absorb the heat energy from the air, preventing the environment from becoming too hot, while in winter, they release the stored heat energy, preventing the environment from becoming too cold. This phenomenon is known as the oceanic or maritime effect, and it results in smaller climate changes in coastal regions, creating more moderate and pleasant weather conditions.

As such, environments located near large bodies of water benefit from a more stable climate, with less temperature variation and greater weather predictability.

For more such answers on Environment near large water bodies
https://brainly.com/question/3666108

#SPJ11

Environments near large bodies of water typically have smaller Climate changes compared to those not near large bodies of water.

The characteristic of water that allows the climate to remain relatively consistent throughout the year is its high specific heat capacity.

Specific heat capacity refers to the amount of heat energy required to raise the temperature of a substance by one degree Celsius. Water has a high specific heat capacity, which means it can absorb and release large amounts of heat energy without significantly changing its temperature.

This property helps moderate the temperature of nearby environments.

In coastal areas, during summer, the large body of water absorbs heat from the sun, maintaining a cooler temperature. The cooler air over the water then helps to lower the temperature on land, creating a milder climate.

In winter, the water releases the stored heat energy, warming the air and preventing extreme cold temperatures in the surrounding area.

In contrast, inland environments without large bodies of water nearby experience more significant temperature fluctuations due to the absence of this temperature-regulating effect. As a result, these areas typically have more extreme climate changes throughout the year.

To Learn More About Climate

https://brainly.com/question/28214569

#SPJ11

Answer:

Succession occurs after sudden catastrophic change.

Explanation:

In communities, organisms occupy specific niches. These gradually evolve over time as these organisms interact with their geosphere. In ecological succession, a community may undergo several dynamic changes. These include primary succession and secondary succession- these communities eventually try to achieve equilibrium over time.

After catastrophic events, the microorganisms, primary succession occurs. Here, a colonizing species exploits a non-habitable region. These eventually make the region more habitable through nutrient cycling, weathering, etc. which ushers in secondary succession. Here, the communities become more complex with time, becoming more varied and an increasingly large food web.

Answer:

amount of copper

Explanation:

The independent variable would be the amount of copper fed into the experimental rats.

An independent variable during an experiment is a variable whose value is not dependent on any other variable being measured in the experiment.

The value of an independent variable is not changed by any other variable in an experiment. In actual fact, the effect of the independent variable is being tested on other variables (dependent variables) in the experiment.

Hence, in an experimental study of the effect of copper deficiency on coat color in rats, the amount of copper fed into the system of the rats will be varied and the effects of this variation on the coat color of the rats would be observed by measuring relevant variables. Therefore, the amount of copper is the independent variable.

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

D is ur answer  Explanation is because its crossed with both which means its 50/100 for both tall and short and that would make a hybrid and that hybrid would be a medium plant btw

Answer:

I think it is A

Explanation:

A would be my andwer

Answer:

Explain in your own words an atom and an element.

Explanation:

A particular atom will have the same number of protons and electrons and most atoms have at least as many neutrons as protons. An element is a substance that is made entirely from one type of atom. For example, the element hydrogen is made from atoms containing just one proton and one electron.

Enzymes are biological catalysts* and enzymes are also a protein

Catalysts* are a substance that can speed up reactions

The group that is incorrect is "muscosa." (option 3) Serous membranes are thin layers of tissue that line various body cavities and organs.

They secrete a lubricating fluid that reduces friction between organs during movement. The two correct types of serous membranes mentioned are pleura and peritoneum. The pleura is the serous membrane that surrounds the lungs and lines the chest cavity, while the peritoneum is the serous membrane that lines the abdominal cavity and covers the abdominal organs. However, "muscosa" is not a correct term for a serous membrane (option 3).

Mucosa, on the other hand, is a different type of membrane that lines the body's internal passages and organs that are exposed to the external environment, such as the respiratory tract, digestive tract, and reproductive system. It secretes mucus to protect and lubricate these passages. Therefore, the correct group of serous membranes consists of pleura and peritoneum, while "muscosa" is not a valid term for a serous membrane.

Know more about muscosa here: https://brainly.com/question/27786353

#SPJ11

The right answer, based on the facts provided, is E binding to DAG and continued Ca2+ present.

1,2-diacylglycerol, which is generated by the receptor-mediated hydrolysis of inositol phospholipids, activates protein kinase C (PKC) (1). The regulatory and catalytic domains are located in the amino- as well as carboxyl-terminal portions, respectively, of PKC's wide family of many isoforms.

These second messengers, diacylglycerol as well as Ca2+, attach to PKC's regulatory modules, the C1 and C2 domains, respectively, activating PKC. PKC is activated by raising the intracellular concentrations both Ca2+ and diacylglycerol; inactivated by lowering these ligands to baseline levels.

To know more about PKC visit:

https://brainly.com/question/29606875

#SPJ4

Answer:

Economic development

Explanation:

Answer: The answer is B

Answer: Option 2- Antibodies present in Recipient plasma. 

Answer:

When determining blood type compatibility before a transfusion, the most important detail about the recipient is their blood type. Specifically, the ABO blood group system is the most important factor to consider. The ABO system includes four blood types: A, B, AB, and O, which are determined by the presence or absence of specific antigens on the surface of red blood cells.

For a successful transfusion, it is important to match the donor's blood type with the recipient's blood type. For example, a person with blood type A can only receive blood from a donor with blood type A or O, but not from a donor with blood type B or AB. Similarly, a person with blood type B can only receive blood from a donor with blood type B or O, but not from a donor with blood type A or AB.

In addition to the ABO blood group system, the Rh factor (positive or negative) should also be considered to ensure compatibility between the donor and recipient.

Explanation:

Answer:

The ocean is divided into five zones: the epipelagic zone, or upper open ocean (surface to 650 feet deep); the mesopelagic zone, or middle open ocean (650-3,300 feet deep); the bathypelagic zone, or lower open ocean (3,300-13,000 feet deep); the abyssopelagic zone, or abyss (13,000-20,000 feet deep); and the

Explanation:

Answer:

Pneumonia is an infection of the lungs caused by bacteria virus fungi or protozoa in rare condition.

Answer:

The chromatophores are pigment-containing cells that occur in the integument and internal organs. Their function is to adjust the body coloration to its surroundings, depending upon the situation (e.g., protection, mating behavior, antagonistic displays).

Explanation:

Answer:

AAG

Explanation:

is the silent one in this case

Answer:

Oxygen, Carbon dioxide

Explanation:

Its a fact