Using the same, non-mutated sequence of DNA , repeat the process you just completed, but this time, for an insertion mutation. Randomly insert a base.

Original DNA gene: GATCGATACCATTCGGCGCATACTTCG

A)The mutated DNA sequence; highlight the insertion mutation.

B)The resulting MRNA sequence for each mutation:


C) The resulting amino acid sequence for each mutation (you will need the codon wheel chart for this):

Note: Begin translation at the first start codon, AUG, that you see when reading the MRNA sequence from left to-right. Stop translating the sequence when you reach first stop codon in the reading frame.

Answers

Answer 1

Answer:

its b

Explanation:

A P E X verified


Related Questions

Identify one of the leadership values you would like to develop further over the course of the next year and propose an improvement plan (tasks, dates, measures of progress). Your plan should be specific, measurable, achievable, relavant and time bound. Leadership values are discussed in Chapter 7 of the text and you can find examples and lists through your own research. These values tend to define your "personal character" or "personal brand" and should be consistent with you actions and behaviour. Examples would include: honesty, hardworking, trustworthy, ethical, loyal, persistent, optimistic, motivating, encouraging, brave, caring, respectful, give and take responsibility, admit to mistakes and learn, accountable, reliable, keep promises, listen and coach others, take initiative, proactive, maintain stamina, positive attitude, etc.

Answers

By following this improvement plan,one can aim to develop and enhance my empathy as a leadership value over the next year.

One leadership value I would like to develop further over the course of the next year is empathy. Empathy is a crucial leadership trait that involves understanding and sharing the feelings of others. It allows leaders to connect with their team members on a deeper level, foster positive relationships, and create a supportive work environment.

Improvement Plan for Developing Empathy:

Research and Study: (July - August): Read books and articles on empathy and its importance in leadership.Attend webinars or workshops focused on developing empathy skills.Engage in discussions with colleagues or mentors who possess strong empathetic qualities.Self-Assessment: (September): Reflect on my current level of empathy and identify areas for improvement.Evaluate past interactions with team members to identify instances where empathy could have been enhanced.Take note of personal biases or preconceptions that may hinder empathetic responses.Active Listening: (October - November): Practice active listening skills, focusing on truly understanding others without interrupting or judging. Demonstrate genuine interest in others' thoughts, feelings, and perspectives. Engage in conversations where I actively seek to understand rather than merely respond.Emotional Intelligence Development: (December - January): Enhance emotional intelligence by recognizing and managing my own emotions effectively. Develop a better understanding of how emotions impact the behavior and well-being of others. Explore strategies for regulating emotions and responding empathetically in challenging situations.Perspective-Taking: (February - March): Put myself in others' shoes to gain a deeper understanding of their experiences, challenges, and motivations.Seek opportunities to learn about the diverse backgrounds and perspectives of team members. Encourage open dialogue and create a safe space for team members to share their thoughts and feelings.Feedback and Reflection: (April - May): Seek feedback from colleagues, team members, and mentors regarding my progress in demonstrating empathy. Reflect on my interactions and evaluate how well I have applied empathy in different situations. Make adjustments based on feedback and continue to refine my empathetic approach.Measures of Progress: Regularly self-assess my empathetic responses and behaviors. Seek feedback from team members regarding their perception of my empathy. Notice an increase in open and honest communication within the team. Observe improved trust, engagement, and satisfaction among team members. Evaluate the frequency and quality of personal connections and relationships established with team members.

By following this improvement plan,one can aim to develop and enhance my empathy as a leadership value over the next year.

To learn more about leadership ,

https://brainly.com/question/25996547

#SPJ4

=) (i) Explain how cholera causes diarrhoea.

Answers

Cholera is a bacterial infection caused by the bacterium Vibrio cholerae. When a person ingests contaminated food or water, the bacteria can enter the small intestine and begin to produce a toxin called cholera toxin.

Cholera toxin works by binding to the cells lining the small intestine, causing them to release large amounts of electrolytes and water. This leads to a significant increase in the volume of fluid in the intestine, resulting in watery diarrhea.

The diarrhea caused by cholera is often described as "rice-water" diarrhea because it has a pale, cloudy appearance similar to water in which rice has been rinsed. The large volume of fluid lost in the diarrhea can quickly lead to dehydration and electrolyte imbalances, which can be life-threatening if left untreated.

Cholera can also cause vomiting, which can further contribute to fluid loss and dehydration. Overall, the combination of diarrhea and vomiting can lead to significant fluid and electrolyte imbalances, which can be fatal if not properly managed.

Why should you not exercise right after a meal? Select all that Apply

your muscles need oxygen

the body cannot supply enough blood to both digestive system and muscles

because your lungs don't function as well

the arteries to the stomach are open wide

the arteries to the leg are open wide

Answers

Answer:

(b) The body cannot supply enough blood to both the digestive system and muscles. (d) the arteries to the leg are open wide.

Explanation:

You shouldn't exercise right after eating a large meal, as you may feel bloating or muscle cramping. It's better to eat low-fiber, low-fat, and high-carbohydrate snacks 30 to 45 minutes before exercising. This can include yogurt, fruit, granola, peanut butter, or whole-wheat toast.

Out of the following four options, the concentration at which dsDNA will have the highest Tm is a.10 mm b.1000 μM c.100 mm d. 1M

Answers

The correct option is C: The concentration at which dsDNA will have the highest Tm is 100 mM.

Which concentration will result in the highest Tm for dsDNA?

Out of the given options, the concentration at which double-stranded DNA (dsDNA) will have the highest melting temperature (Tm) is 100 mM. Tm is the temperature at which half of the DNA strands in a double helix become denatured or separated.

It is influenced by factors such as DNA sequence, length, and ionic conditions, including the concentration of ions in the solution. In general, increasing the concentration of salt ions, such as potassium or magnesium, can stabilize the double helix and raise the Tm.

In this context, a concentration of 100 mM is likely to provide an optimal ionic environment for maintaining the stability of dsDNA, resulting in a higher Tm compared to lower or higher concentrations. It is important to note that the Tm can vary based on the specific DNA sequence and experimental conditions.

Learn more about concentration

brainly.com/question/3045247

#SPJ11

What type of phrase is “enrolling him in puppy class”?

Answers

Answer:

Adverbial Phrases: A group of words that together, function as an adverb.

what phenotype can male cats NOT express?

Answers

Answer:

Hope you're doing well.

Explanation:

Male cats cannot express the phenotype of being a heterozygous carrier of a sex-linked trait located on the X chromosome because they only have one X chromosome. In male cats, the sex-linked traits are always expressed, whether dominant or recessive, because they have no corresponding gene on the Y chromosome to mask the expression. As a result, any sex-linked trait on the X chromosome is always expressed in male cats, regardless of whether it is dominant or recessive.

The reason it is called a Frameshift mutation is because it alters the "reading frame" of the bases. The bases are normally read as

A. codons, in groups of 3

B. nitrogen bases, in groups of 2

C. anti-codons, in groups of 4

The reason it is called a Frameshift mutation is because it alters the "reading frame" of the bases.

Answers

Answer:

A. codons, in groups of 3

Explanation:

The reason it is called a Frameshift mutation is because it alters the "reading frame" of the bases. The bases are normally read as codons, in groups of 3.

codons, in groups of 3. The reason it is called a Frameshift mutation is because it alters the "reading frame" of the bases. The bases are normally read as codons, in groups of 3.

What are Codons?

Codons are units of genomic information made up of three nucleotides (trinucleotides) in DNA or RNA that code for a specific amino acid or indicate the end of protein synthesis (stop signals).

There are 64 distinct codons, of which 3 serve as stop signals and 61 identify amino acids.

The messenger RNA is made using the DNA as a template, which is subsequently used to create a particular protein. The bases that make up DNA and the associated messenger RNA are called bases. These nucleotides are frequently identified in RNA by the letters A, U, C, and G.

Therefore, Codons, in groups of 3. The reason it is called a Frameshift mutation is because it alters the "reading frame" of the bases. The bases are normally read as codons, in groups of 3.

To learn more about Codons, refer to the link:

https://brainly.com/question/22991780

#SPJ2

question 3 if a population is at hardy-weinberg for a locus with two alleles, is there any allele frequency at which the heterozygote frequency is lower than both (individually) of the two homozygous frequencies? for example, with alleles a and a, and assuming hw, is there a frequency of a (called p) wherein the expected aa genotype frequency is rarer than the expected aa frequency and the expected aa frequency is rarer than the expected aa frequency?

Answers

In a population at Hardy-Weinberg equilibrium for a locus with two alleles, there is no allele frequency at which the heterozygote frequency is lower than both of the two homozygous frequencies.

Under Hardy-Weinberg equilibrium conditions, the frequency of heterozygotes (individuals with one copy of each allele) is equal to the product of the frequencies of the two alleles. This means that the frequency of heterozygotes can never be lower than the frequencies of either of the two homozygotes (individuals with two copies of the same allele). In other words, if a population is at Hardy-Weinberg equilibrium for a locus with two alleles, there is no allele frequency at which the heterozygote frequency is lower than both of the two homozygous frequencies. For example, consider a locus with two alleles, A and a. Let p be the frequency of the A allele and q be the frequency of the a allele. The Hardy-Weinberg equilibrium equation for the frequency of heterozygotes (individuals with one copy of each allele) is: Heterozygote frequency = pq The Hardy-Weinberg equilibrium equation for the frequency of homozygotes (individuals with two copies of the same allele) is: AA frequency = pp aa frequency = q^2. Since p and q are between 0 and 1, it is not possible for either p or q to be less than 0, and therefore it is not possible for either p^2 or q^2 to be less than 0. Therefore, it is not possible for the frequency of either of the two homozygotes to be less than 0. Since the frequency of heterozygotes is equal to pq, which is the product of p and q, and since both p and q are greater than or equal to 0, it is not possible for the frequency of heterozygotes to be less than either of the two homozygotes. Therefore, in a population at Hardy-Weinberg equilibrium for a locus with two alleles, there is no allele frequency at which the heterozygote frequency is lower than both of the two homozygous frequencies.

To know more about alleles

https://brainly.com/question/7602134

#SPJ4

Ouch. You step on a tack and jrk away without even thinking. Then you decide to pick up the tack and put it on your desk. Which body systems are involved?

Answers

Answer: The body systems that are involved are:

--> Nervous System and

--> muscular system.

Explanation:

The body is made up of different organ systems which usually works together to bring about proper functioning of the living organism. Examples of the body systems includes:

--> The nervous system: This system enables the animal to detect and respond to stimuli rapidly.

--> The muscular system: This system enables the organism to move from one location to another.

Both the nervous system and the muscular system work together to bring about coordination of activities. When you step on a tack and jeck away, sensory receptors detects stimuli from the external environment and pass the information received as an electrical impulses to the brain through the nerve fibres. The information is processed in the central processing region which is the brain.

The effectors such as the muscles goes into action upon receiving nerve impulses from the brain. Such actions includes muscular contractions which helps you to pick up the tack and put it on your desk.

Pls help thank you will mark the Brainliest

Pls help thank you will mark the Brainliest

Answers

The arrangement of circles taht best illustrates the relationship between the genus and species of Canis familiaris, the domestic dog is Option 1 where familiaris is a subset of Canis.

What are genus and species?

Genus and species are terms used in the scientific classification of living organisms, also known as taxonomy.

A genus is a taxonomic rank used to group together closely related species. It is a level of classification above species and below family. Organisms within the same genus share many similarities in their characteristics, such as their physical features, behavior, and genetic makeup.

A species is the basic unit of classification in biology. It is a group of organisms that share common characteristics and can interbreed to produce fertile offspring. Each species is given a unique two-part scientific name, consisting of its genus name and its species name, such as Homo sapiens for humans or Canis lupus for wolves.

Together, genus and species names form what is called a binomial or scientific name, which is used to refer to a specific organism.

Learn more about genus and species at: https://brainly.com/question/346710

#SPJ1

Compare

Compare the charges and masses of
protons, neutrons, and electrons.

Answers

Answer:

Protons and neutrons have very similar mass, while electrons are far lighter, approximately 11800 times the mass.

Protons are positively charged, neutrons have no electric charge, electrons are negatively charged. The size of the charges is the same, the sign is opposite.

Explanation:

Hope this helps!!
Mark me brianliest and Good luck :)))

The image shown above describes which type of reproduction?
A) sexual
B) asexual
C) budding
D) grafting

The image shown above describes which type of reproduction?A) sexualB) asexualC) buddingD) grafting

Answers

Answer:

b) asexual

Explanation:

kyyyttgbjoljfefbkokde

Which molecules can be purified and what techniques are used for them? what's the purpose to purify them?

Answers

Many different types of molecules can be purified, including proteins, nucleic acids, small organic compounds, and more. Various techniques are used for purification depending on the nature of the molecule and the desired level of purity.

Chromatography: Separates molecules based on their affinity for a stationary phase and mobile phase, such as column chromatography, affinity chromatography, or size exclusion chromatography. Electrophoresis: Separates molecules based on their charge and size, such as gel electrophoresis or capillary electrophoresis. Filtration: Removes larger particles or unwanted contaminants by passing the mixture through a filter with defined pore size.

Learn more about proteins here;

https://brainly.com/question/30986280

#SPJ11

Which substance is harmful in drinking water at any amount?

A) Nitrates
B) Pesticides
C) Charcoal
D) Coliform Bacteria

Answers

Answer:

B

Explanation:

Its a poison stay away from it no matter how much it is

The answer should be a or b .

From the information on linkage, chromosomal mapping, and many associated phenomena, what answers would you propose to the following fundamental questions?
Part A
How was it established experimentally that the frequency of recombination (crossing over) between two genes is related to the distance between them along the chromosome?

Answers

Crossing over is the exchange of chromosome segments between non-sister chromatids during meiosis. This process is one of the mechanisms responsible for genetic diversity and also serves as the basis for genetic mapping. Genetic mapping is used to determine the position of genes on a chromosome.

To establish experimentally that the frequency of recombination between two genes is related to the distance between them along the chromosome, the following steps must be followed: The frequency of recombinants is determined by cross-breeding parent organisms with different traits. Determining the distance between the two genes is the next step in the process. This is accomplished by observing the percentage of recombinant progeny that result from a particular cross. The distance between the genes is proportional to the frequency of recombinant progeny. Crossing over occurs more frequently between genes that are far apart on the chromosome than those that are close together. As a result, genes that are close together are less likely to cross over and produce recombinant offspring.

To determine the distance between genes on the chromosome, a mapping function is used. By analyzing the frequency of recombinant progeny resulting from different crosses, the distance between the genes can be calculated. This distance is proportional to the frequency of recombinants.

To know more about Crossing over visit:-

https://brainly.com/question/31863061

#SPJ11

Which of these statements is true?
c. The best fossils are formed during a cataclysmic event.
a. Younger strata are usually nearer the surface.
d. Rock strata are formed by volcanic activity.
e. Water’s ability to erode rock helps to explain how fossils are formed.
b. More recent fossils are in the deepest

Answers

'Younger strata are usually nearer the surface' is the true statement.

What do you mean by Strata?

Strata is a term that refers to the various layers of a rock formation. The term is used in a variety of fields, including geology, archaeology, and petrology. It describes the various layers of sedimentary rock that have been formed over time, as well as the different types of sedimentary rock that can be found in a strata.

This statement is true because younger strata (layers of rock or sediment) are generally deposited more recently and are therefore closer to the surface than older strata. This is because over time, as the Earth's surface erodes and is reshaped by various natural forces, the most recently deposited layers tend to be more exposed.

Hence, Option B is correct.

To know more about strata,

https://brainly.com/question/23437558

#SPJ1

Correct form of question:

Which of these statements is true?

a. The best fossils are formed during a cataclysmic event.

b. Younger strata are usually nearer the surface.

c. Rock strata are formed by volcanic activity.

d. Water’s ability to erode rock helps to explain how fossils are formed.

e. More recent fossils are in the deepest.

are cells the basic unit of life

Answers

Yess

Cells are considered the basic units of life in part because they come in discrete and easily recognizable packages. That's because all cells are surrounded by a structure called the cell membrane — which, much like the walls of a house, serves as a clear boundary between the cell's internal and external environments.

Halons contain halogens, which are highly reactive with oxygen. please select the best answer from the choices provided t f

Answers

Answer:

IT"S TRUE  

Explanation:

TRUE!

E 2022

What is the centrosome region?

Answers

Answer:

​Centrosome

A centrosome is a cellular structure involved in the process of cell division. Before cell division, the centrosome duplicates and then, as division begins, the two centrosomes move to opposite ends of the cell.

Explanation:

a student is completing a punnett square for a trait (x/x) that is autosomal and inherited by the dominant allele. the father does not have it (xx), but the mother does (xx). if they had two children, a son and a daughter, what would the completed punnett square look like (i.e., would the son have the trait, would the daughter have the trait)?(1 point) responses both children would inherit the trait. both children would inherit the trait. one child would inherit the trait and one child would not. one child would inherit the trait and one child would not. each child has a 50% chance of inheriting the trait. each child has a 50% chance of inheriting the trait. both children would not inherit the trait.

Answers

In the punnett square analysis, each child has a 50% chance of inheriting the trait. Some genetic illnesses are caused by dominant alleles. The condition is caused by inheriting just one copy of such a dominant allele.

Huntington disease, achondroplastic dwarfism, and polydactyly are examples of this. Heterozygous (Aa) individuals are not healthy carriers.

The mother Xx has the trait and the father xx doesn't.

Using the punnet square

Xx                 xx

Xx   Xx  xx  xx

There are just two traits which are Xx and xx which are in equal frequency and proportion.

This therefore means that the children have a 50% chance of getting the trait.

Learn more about to   punnett square visit here;

https://brainly.com/question/27984422

#SPJ4


During the development of red-eared slider turtle embryos, which factor
directly regulates gene expression before transcription occurs?
A. Calcium ion levels in the cell
B. Hours of daylight in the environment
C. The types of surrounding cells
D. Oxygen concentration in the cell

During the development of red-eared slider turtle embryos, which factordirectly regulates gene expression

Answers

Answer: Calcium ion levels in the cell

Explanation: I just did the quiz

A. Calcium ion levels in the cell directly regulates the gene expression before transcription occurs.

Why Calcium ion levels in the cell directly regulates gene expression before transcription occurs?

Calcium ion levels in the cell directly regulate gene expression before transcription occurs during the development of red-eared slider turtle embryos. Calcium ions are important second messengers that are involved in many cellular signaling pathways. In particular, the release of calcium ions from intracellular stores in response to specific signals can activate various signaling pathways that regulate gene expression. Calcium ions can bind to and activate transcription factors, which are proteins that directly regulate the expression of specific genes by binding to DNA sequences near the genes' promoter regions. This can initiate the process of transcription, in which RNA molecules are synthesized from the DNA template.

Therefore, calcium ion levels play a crucial role in regulating gene expression during embryonic development.

To know more about embryonic development of turtle, just go to the given link:

https://brainly.com/question/9952850

#SPJ1

The self-complementarity within each strand confers the potential to form 1 hairpin, cruciform. 2 hairpin, B-form 3 palindrome, cruciform 4 palindrome, B-form

Answers

La autocomplementariedad de cada cadena de ADN o ARN permite la formación de estructuras como hebras y cruciformes. Estos motivos estructurales son fundamentales en el plegamiento de ADN y ARN, la regulación génica y otros procesos biológicos.

La autocomplementarity de cada cadena de DNA o RNA permite la formación de varios motifs estructurales. Particularmente, esta autocomplementarity concede la capacidad de crear hebras y estructuras cruciformes. In the case of one hairpin, a single strand folds back on itself, creating a stem-loop structure. El patrón de enrollamiento más complejo es el resultado de dos estructuras de nudo que involucran dos regiones complementarias dentro del mismo rollo. Sin embargo, los palindromes muestran repeticiones invertidas dentro de una fibra, lo que permite la unión de pares de base y la formación de estructuras de forma cruciforme o B. These structural motifs are crucial in DNA and RNA folding, gene regulation, and other biological processes.

learn more about autocomplementariedad here:

https://brainly.com/question/29336206

#SPJ11

Every DNA strand has the ability to produce hairpin structures due to its self-complementarity. When a single strand curls back on itself, creating a stem-loop structure, the result is a hairpin structure.

Hydrogen bonds formed between complementary nucleotides in the same strand help to stabilise this structure.The term "cruciform" describes a DNA structure that takes on a cruciform shape when two hairpin structures inside the same DNA molecule align in an antiparallel direction. Palindromic sequences, which are DNA sequences that read the same on both strands when the directionality is ignored, are frequently linked to cruciform formations.The usual right-handed double helical DNA helix, which is most frequently seen under physiological settings, is referred to as being in "B-form" instead.

learn more about complementarity here  :

https://brainly.com/question/31868107

#SPJ11

in reproduction, genetic information comes from only one parent; whereas, in reproduction, genetic information from two parents unites to form an offspring.

Answers

In asexual reproduction, genetic information comes from only one parent; whereas, in sexual reproduction, genetic information from two parents to form an offspring.

What is asexual reproduction?

Asexual reproduction is a type of mechanism by which only one parental organism may produce offspring and therefore it is not associated with the formation of gametes.

In sexual reproduction, the cells from different parents having half genetic material fuse to produce an egg that will develop into an adult organism by a process known as fertilization.

The different types of asexual reproduction in organisms include, among others, vegetative propagation, binary fission (bacteria), Budding, fragmentation division, reproduction by spores (sporogenesis), etc.

In conclusion, in asexual reproduction, genetic information comes from only one parent; whereas, in sexual reproduction, genetic information from two parents to form an offspring.

Learn more about asexual reproduction here:

https://brainly.com/question/423209

#SPJ1

is the force of attraction that exists and holds atoms
together.

Answers

Answer:

covalent bond.

What are the flattened membranes in chloroplasts called?
O A. Stroma
OB. Thylakoids
C. Photosystems
D. Photons

Answers

Answer:

Thylakoids

Explanation:

The answer is
OB. thylakoids

how would you determine the zone of inhibition if the zone of two antibiotic discs overlapped each other?

Answers

The zone of inhibition is the clear area around the antibiotic disc where the bacteria growth is inhibited.

If the zones of two antibiotic discs overlap, it can be challenging to determine the exact size of the zone of inhibition. To determine the zone of inhibition when two discs overlap, there are a few different methods that can be used. One method is to measure the diameter of each disc separately and then measure the diameter of the overlapping zone.

The diameter of the overlapping zone can be subtracted from the sum of the diameter of each disc to obtain the approximate zone of inhibition. Another method is to compare the zone of inhibition of the overlapping discs to the zone of inhibition of a single disc of each antibiotic.

If the zone of inhibition of the overlapping discs is larger than that of a single disc, it can be assumed that the overlap has increased the effectiveness of the antibiotics. However, if the zone of inhibition is smaller than that of a single disc, it can be assumed that the overlap has reduced the effectiveness of the antibiotics.


Overall, determining the zone of inhibition when two antibiotic discs overlap can be challenging. It is important to use multiple methods and to consider the potential effects of the overlap on the effectiveness of the antibiotics.

Know more about Antibiotic disc here :

brainly.com/question/31146542

#SPJ11

You have probably seen movies depicting the world after natural disasters have changed the climate, or reduced the availability of food, water, or even space to live. Work with a partner to brainstorm what could happen in one of these situations. Then write a short movie script describing what might happen in your community if these resources became very limited.

Answers

Answer: Soil erosion, Global Warming caused by the rise of greenhouse gases- Extinction of species and loss of biodiversity, Flooding, and drought could happen if disasters have changed the climate, or reduced the availability of food, water, or even space to live.

Explanation: Hope this helped

With rising worldwide surface temperatures, there is a greater chance of more droughts and stronger storms. As more water vapour evaporates into the atmosphere, it serves as fuel for the development of more intense cyclones.

What are the effects of climate change and natural catastrophes on our ecosystem and people?

Climate change is indeed having an effect on health in a variety of ways, including the increased frequency of severe weather events such as heatwaves, cyclones, and floods, the disruption of food systems, rises in zoonoses and food-, water-, and vector-borne illnesses, and mental health problems.

Why is climate change a potential disaster?

Climate change will thus affect disaster risks in two ways: first, by increasing the likelihood of weather and climate hazards, as well as the effects of sea-level rise; and second, by increasing the vulnerability of communities to natural hazards as a result of ecosystem degradation, water and food shortages.

To know more about climate change, visit

brainly.com/question/13105326

#SPJ1

Question 2 of 26
Which statement correctly describes the relationship between technology
and science?
OA. Scientific discoveries cannot be made without the use of modern
technology.
B. As technology advances, science becomes less important.
OC. Advancements in technology can enable new scientific
discoveries.
OD. Technology can be used only by scientists.
SUBMIT

Answers

Technological development can enable new scientific discoveries describes the relationship between science and technology.

What is the latest advancement in technology?

Technology advances when technologies or applied sciences become more accurate, precise, effective or efficient or capable. The development of science and technology has made many important changes.

Advanced technology is defined as a new or emerging IT innovation that still has relatively few users but promises to create significant future value. Although this term is distinct from both advanced manufacturing technology and manufacturing technology, they are related.

By 2022, multi-core will be everywhere, from mobile phones and smartphones to cameras, games, cars, cloud servers and advanced supercomputers. Silicon photonics is the core technology to address  bandwidth.

Learn more about the technology:

https://brainly.com/question/9171028

#SPJ9

In an ecosystem, organisms use up
chemical energy and most of the
energy is then lost to the
environment as
A. light
B. heat
C. photons

Answers

B is the correct answer

Which organelle acts like the mail room of the cell?

A. The ribosome
B. The vacuole
C. The Golgi apparatus
D. The endoplasmic reticulum

Answers

Answer:

C) The Golgi apparatus

Explanation:

he Golgi apparatus works like a mail room. The Golgi apparatus receives proteins from the rough ER and puts "shipping addresses" on them. The Golgi then packages the proteins into vesicles and sends them to the right place in the cell or to the cell membrane.

Other Questions
What did many African-Americans do as the quality of life continued to deteriorate in the South? A sample of chlorine gas occupies 150.0 ml when its pressure is 615 torr. how many milliliters will the gas occupy when its pressure is 795 torr? the process by which managers monitor efficiency and effectiveness by monitoring performance, comparing it with goals, and taking corrective action is called ______. True or False? A function has exactly one return statement. A function has at least one return statement. A function has at most once return value. A procedure (with return value void) never has a return statement. When executing a return statement, the functions exists immediately. A function without parameters always has sideeffects. A procedure (with a return value void) always has a side effect. A function without side effects always returns the same value when called with the same parameter values. Need help ASAP please thank u In a (n) _____ climate, average temperatures during the cold months do not go below 27 F (-3C). Please provide a step-by-step Thank you so much!!!! Simplify and state the values of the variables where the expressions are undefined. g Highest Response Ration-Next Scheduling (HRNN): Consider Process P1 has a declared service time of 5 seconds and has been waiting for 20 seconds. Process P2 has a declared service time of 3 seconds and has been waiting for 9 seconds. If the system uses HRNN which process will execute first and why one of the practical implications of the existence of the nash equilibrium is that game theory can be fruitfully used to analyze real-world economic problems. true or false Let n be a whole number, and consider the statements below. p: n is a multiple of two. q: n is an even number. Which of the following is equivalent to ~q ~p? ~q ~p q p p q ~p ~q list the cause of natural resources in your locality and classify them as a nature anthropogenic cause Which lines best complete the sentence? Select 3 options. Grendel, by John Gardner, is written in first person to show a single perspective. to tell an old story from a new point of view. so that Beowulfs feelings can be understood. with Grendel acting as a first-person narrator. using first person to show Hrothgars perspective. A female originally from Haiti who comes to work at Verizon in the United States is likely to have which of the following reactions to the culture of the company? She is likely to feel that her thoughts and opinions are valued within the organization. what is 20,700,0000 in standard notation? If someone is seriously injured in a collision, what should you do? How much work must be done to stop a 1200 kg car traveling at 95 km/h? Express your answer using two significant figures. 17 ? For which of the following is the number the same in human males and females? a. interruptions in meiotic divisions b. functional gametes produced by meiosis c. meiotic divisions required to produce each gamete d. different cell types produced by meiosis What is the relationship between chromosome numbers in body cells and sex cells? a patient admitted to the rehabilitation center 1 week ago has lost weight and has a decreased serum prealbumin level. which nutritional recommendation would the nurse expect from the registered dietitian nutritionist Which characteristic that may pose a potential nutrition problem would the nurse identify in a preterm neonate?1. Inadequate sucking reflex2. Diminished metabolic rate3. Rapid digestion of formula4. Increased absorption of nutrients