TRUE/FALSE. the inflammatory process involves a cascade of events that results in dilation of blood vessels, leakage of fluid from those vessels, and migration of leukocytes out of the bloodstream and into the tissues.

Answers

Answer 1

The inflammatory process involves a cascade of events that results in the dilation of blood vessels, leakage of fluid from those vessels, and migration of leukocytes out of the bloodstream and into the tissues is true.

When tissues are damaged by an infection, trauma, toxin, heat, or any other cause, the inflammatory response, also known as inflammation, takes place. Chemicals like histamine, bradykinin, and prostaglandins are released by injured cells. These medications result in edema by causing blood vessels to leak fluid into tissues.

To reach sites of infection, injury, and stress inside the interstitium, neutrophils, monocytes, and effector T lymphocytes must pass through active venular walls.

Due to their inability to swim, leukocytes must be transported locally to the site of inflammation via a variety of adhesive procedures that enable them to stick to the vessel wall and travel along it to the endothelial boundaries.

Learn more about inflammation at

https://brainly.com/question/28546567?referrer=searchResults

#SPJ4


Related Questions

q6.6. what statement below is true of the spindle during mitosis and meiosis? the spindle always separates sister chromatids during anaphase. the spindle always separates homologous chromosomes during anaphase. chromosomes are always attached to both spindle poles during metaphase. the spindle always attaches to chromosomes at the kinetochore.

Answers

The statement that is true of the spindle during both mitosis and meiosis is that it always attaches to chromosomes at the kinetochore. The kinetochore is a protein structure that forms at the centromere of each chromosome and serves as the attachment site for microtubules of the spindle.

During both mitosis and meiosis, the spindle fibers attach to the kinetochores of each chromosome and exert force to align them at the metaphase plate. Then, during anaphase, the spindle fibers pull the sister chromatids (in mitosis) or homologous chromosomes (in meiosis) apart towards opposite poles of the cell.

Therefore, the spindle plays a critical role in the segregation of genetic material during cell division.
 

While the spindle plays a crucial role in separating sister chromatids and homologous chromosomes, its primary function is to attach to chromosomes at the kinetochore to facilitate these processes.

To know more about mitosis visit:

https://brainly.com/question/29776367

#SPJ11

11. Define reproduction

Answers

Answer:

"Reproduction refers to the production of offspring by organized bodies. The offspring is produced as a new individual organism from the parent(s). It is one of the fundamental attributes of a living thing."

-Biologyonline.com

Which feature of Earth is part of the geosphere?
O air
O fish
O rocks
Oglaciers
HELP ME PLEASEEEEE

Answers

Answer:

Rocks

Explanation:

Geo means “earth.” The Earth’s geosphere (sometimes called the lithosphere) is the part of the Earth that includes all the rocks, minerals and landforms of the surface and interior that make up the Earth. It starts at the ground and extends all the way down to Earth’s core.

The feature of the Earth that is part of the geosphere is rocks. The correct option is C.

What is the geosphere?

The geosphere is made up of every rock on Earth, from the melting rock beneath the crust to the massive, age-old mountains to the sand grains on the seashore.

The biosphere, a global ecosystem that includes all life on Earth, has a home in both the geosphere and the hydrosphere and lithosphere, etc. Organisms live in both, the geosphere and the hydrosphere.

The geosphere is always moving because the tectonic plates are always moving, and they sometimes collided with each other. The formation of new landmass, volcano eruptions, lava, molten magma, plants and other things, earthquakes, etc. all happened in the geosphere.

Thus, the correct option is C. rocks.

To learn more about the geosphere, refer to the link:

https://brainly.com/question/4210222

#SPJ6

are fatty acids molecules yes or no

Answers

Answer:

Is fatty acid a molecule?

Fatty acid molecules are usually joined together in groups of three, forming a molecule called a triglyceride. Triglycerides are also made in our bodies from the carbohydrates that we eat. Fatty acids have many important functions in the body, including energy storage.

Explanation:

Answer:

yes

Explanation:

a little summary how ultraviolet light could be the answer to the future outbreak
( Two paragraphs).

Answers

Ultraviolet light can be the answer to future outbreaks because it has the capability to kill the microorganisms present in air and thus can prevent the infectious diseases caused by them.

Ultraviolet light is the EM radiation with the wavelength range 10 nm to 400 nm. It is already being used in research labs for maintaining the microbe free environment. Researches are also being conducted to produce such ceiling lights that can be used normally in households so that the the air-borne microorganisms can be killed.

Microorganisms are the small living organisms not visible to the unaided eyes. They have the strong capability to produce their new variants by mutation and cause infectious diseases. The ultraviolet light can kill them even before they are able to transform themselves.  

To know more about microorganisms, here

brainly.com/question/14754874

#SPJ1

Why does the rising water cool?

Answers

Answer: As the water gets further from the heat source it cools

Explanation:

questions in the attached img. someone help me pls​

questions in the attached img. someone help me pls

Answers

Answer:

A. Medicine — Plasmids are used as an anti-stress medicine to cope with stress-related conditions. It is also used replicate proteins. It is also used in gene therapy.

B. Agriculture — It is used for metal resistances. It is also used for antibiotic resistances. It provide bacteria with genetic advantages.

in a certain ecosystem, field mice are preyed on by snakes and hawks. the entry of wild dogs into the system adds a third mouse predator. what would be the most likely short-term result of this addition?

Answers

In the given ecosystem, the most likely short-term result of the addition of wild dogs as a third mouse predator would be an increase in predation pressure on the field mice population.

As wild dogs start preying on mice along with snakes and hawks, the overall number of field mice being consumed will likely rise.

Consequently, the field mice population may experience a decline, which can lead to a temporary imbalance in the ecosystem.

This decrease in the prey population might also intensify competition among the three predators (snakes, hawks, and wild dogs) for the available field mice.

In turn, this increased competition may affect the populations of snakes and hawks, as they now have to share their food source with wild dogs.

Moreover, the availability of other prey species in the ecosystem would play a crucial role in determining the overall impact of wild dogs' entry.

If alternative prey is scarce, the short-term consequences of the additional predator could be more severe for the field mice population, as well as for snakes and hawks.

In summary, the most likely short-term result of wild dogs entering the ecosystem as a third mouse predator would be an increase in predation pressure on field mice, leading to a decline in their population and intensified competition among the predators.

For more such answers on ecosystem

https://brainly.com/question/842527

#SPJ11

Can biofilm protect from disease?

Answers

Answer:

Biofilms are slimy, glue-like membranes that are produced by microbes in order to colonize surfaces. They protect microbes from the body's immune system and increase their resistance to antibiotics

(8 points)
Were the results the same for all the locations in your field study, or different? How do the
areas you monitored compare in air pollution? Based on your knowledge of the area, give a
possible explanation for the differences. Include a table showing the results of your
monitoring of local air quality
Answer:

Answers

The sensors on air quality monitors are built to find particular pollutants. While some rely on satellite images to assess the amount of energy reflected or radiated by the Earth.

What are the primary air contaminants that are being monitored to assess the air quality explain each?

The most fundamental is the Ambient Air Monitoring Program, which compiles information on certain pollutants that affect national air quality: Lead (Pb), Particulate Matter (PM), Carbon Monoxide (CO), Nitrogen Oxides (NO2 and NO3), Ozone (O3), and both particles with aerodynamic sizes under 10 micrometres (PM-10)

What does air quality monitoring entail?

Monitoring is a process used to gauge a location's level of background air pollution.

To know more about pollutants visit:-

brainly.com/question/28519286

#SPJ1

(WILL GIVE BRAINLY) A species of fox lives in the arctic where the ground is covered in white snow most of the year.  These arctic foxes hunt rodents and other small mammals, while their predators include eagles, wolves, and polar bears.  A mutation in its DNA causes a fox to have white fur rather than brown.  Given this information, would you classify this mutation as a harmful, beneficial, or neutral mutation?  Would this make the fox more or less likely to survive?  Explain your answer.​

Answers

Answer:

it beneficial to These arctic foxes

Explanation:

bc the arctic fox's lives in the arctic where the ground is covered in white snow most of the year.  These arctic foxes hunt rodents and other small mammals, while their predators include eagles, wolves, and polar bears.

mutation in its DNA causes a fox to have white fur rather than brown. gives the arctic foxes an advantage in its environment

There are n bacteria and one virus in a Petri dish. Within the first minute, the virus kills one bacterium and produces another copy of itself, and all of the remaining bacteria reproduce, making 2 viruses and 2(n−1) bacteria. In the second minute, each of the viruses kills a bacterium and produces a new copy of itself, resulting in 4 viruses and 2(2(n−1)−2))=4n−8 bacteria. Again, the remaining bacteria reproduce. This process continues every minute. Will the viruses eventually kill all the bacteria? If so, give an algorithm that computes how many steps it will take. How does the running time of your algorithm depend on n ?

Answers

The viruses will eventually kill all the bacteria. The running time of the algorithm is approximately O(log n).

Yes, the viruses will eventually kill all the bacteria. The number of bacteria decreases with each step, while the number of viruses doubles. The algorithm for determining the number of steps increments the step until the number of remaining bacteria becomes zero.

The running time of the algorithm is approximately logarithmic in nature, as the number of steps required to eliminate all bacteria grows logarithmically with the initial number of bacteria, n. This means that as the number of bacteria increases, the running time of the algorithm increases at a slower rate, making it an efficient approach for large values of n.

To learn more about bacteria follow the link:

https://brainly.com/question/15490180

#SPJ4

3. Describe an example of a symbiotic relationship involving humans

Answers

Answer: Humans have a mutualistic relationship with microorganisms, primarily bacteria, in their digestive tract. Bacteria aid in digestion and regulate the intestinal environment, and in return, they feed off of the food humans eat.

Explanation:Humans have a mutualistic relationship with microorganisms, primarily bacteria, in their digestive tract. Bacteria aid in digestion and regulate the intestinal environment, and in return, they feed off of the food humans eat.

One of the examples of a symbiotic relationship involving humans is the mutual relationship of humans with microbes like bacteria in their digestive tract.  

Symbiosis refers to an ecological relationship between two organisms from distinct species.  

• The different kinds of symbiosis are mutualism, commensalism, parasitism, predation, and competition.  

• Generally, symbiosis means mutualistic symbiotic association. In this, both the organisms are benefitted.  

Humans show a mutualistic association with the microbes like bacteria present in their digestive tract. These bacteria help in digestion and monitor the environment of the intestine, and in return, they feed on the foods consumed by humans.

To know more about:

https://brainly.com/question/15195446

Plants living in regions where water supplies in the soil are low develop various adaptations to aid in their survival. Suggest FOUR of these adaptations.

Answers

Plants living in regions with limited water availability have evolved various adaptations to cope with the challenging conditions.

Four common adaptations seen in such plants:

1)Succulence: Many plants in arid regions have evolved succulent structures to store water.

These plants typically have fleshy leaves, stems, or roots that can store significant amounts of water during periods of rainfall.

The stored water can then be utilized during times of drought, allowing the plant to survive extended periods without rainfall.

2)Reduced leaves or spines: To minimize water loss through transpiration, plants in arid environments often have reduced leaves or modified leaf structures.

For example, some plants have small, needle-like leaves or spines that help reduce the surface area exposed to the hot and dry air, thereby reducing water loss.

3)Deep root systems: Plants adapted to arid conditions often possess deep root systems that enable them to access water from deeper soil layers.

These extensive root systems can tap into groundwater sources or reach areas with higher moisture content, allowing the plant to survive when surface water is scarce.

4)CAM photosynthesis: Crassulacean acid metabolism (CAM) is a specialized form of photosynthesis that many arid-adapted plants employ.

CAM plants open their stomata and take in carbon dioxide during the night when temperatures are cooler and water loss through transpiration is reduced.

They store the carbon dioxide as an organic acid and utilize it during the day for photosynthesis when the stomata remain closed to conserve water.

These adaptations enable plants to conserve and efficiently utilize water, enhancing their chances of survival in regions with low water supplies.

For more questions on Plants

https://brainly.com/question/19393475

#SPJ8

I need someone to explain this

I need someone to explain this

Answers

it would be carbon dioxide and oxygen. the carbon dioxide is exhaled by the human and then the plant takes it in. the plant exhales the oxygen and the human inhales it. and it continues in a circle over and over.

Do you think the skater will make it over the first hump?
(no friction on the track)

A- no, because his potential energy will be converted to thermal energy
B- no, because he doesn’t have enough potential energy
C- yes, because all of his potential energy will be converted to kinetic energy
D- yes, because some of his energy will be potential and some kinetic

Do you think the skater will make it over the first hump?(no friction on the track) A- no, because his

Answers

Answer:

B- no, because he doesn’t have enough potential energy

simple is that

How would you describe the relationship between the hornworm caterpillar and
tomato plant? Do they have a symbiotic relationship? Explain your reasoning.

Answers

Answer:

See the answer below

Explanation:

The hornworm caterpillar and tomato plant do not have a symbiotic relationship. Instead, what they have what can be described as an antagonistic relationship.

In antagonistic relationships, one of the organisms benefits while the other is affected negatively. In some cases, the two organisms in antagonistic relationships are affected negatively.

The hornworm caterpillar feeds on the tissues of the tomato plant, a situation that can lead to the death of the tomato plant if it persists for long. Hence, the hornworm benefits while the tomato plant is negatively affected.

Explain the structure of the nucleus in a living cell​

Answers

Answer:

The nucleus contains nearly all of the cell's DNA, surrounded by a network of fibrous intermediate filaments and enveloped in a double membrane called the "nuclear envelope". The nuclear envelope separates the fluid inside the nucleus, called the nucleoplasm, from the rest of the cell.

hope that helps<3

Answer:

Look at the explanation

Explanation:

Nucleus is situated in the cytoplasm of the cell.

Usually, it is round but many different shaped nuclei can be seen in some cells.

It is surrounded by two porous membranes called nuclear membranes which remain continuous with the Endoplasmic Reticulum.

Within the nuclear membrane is present a liquid substance called nucleoplasm.

Nucleoplasm contains two types of chromatin material: Heterochromatin and Euchromatin.

Chromatin fibres are thin thread-like structures composed of DNA and proteins.

These fibres condense to form short thick chromosomes during cell division and become visible.

DNA molecules transfer hereditary information from one generation to the next.

Hope this helps!

GIVING BRAINLIEST!!! (NO LINKS PLS! LINKS DONT WORK FOR ME )
Which of these is a non-renewable resource?

A) Trees
B) Water
C) Fuel
D) Wind

Answers

Answer:

C. Fuel

Plz give brainliest

Explanation:

What are the three (3) main types of plate boundaries?

Answers

Answer:

Convergent boundaries: where two plates are colliding. Subduction zones occur when one or both of the tectonic plates are composed of oceanic crust.

Divergent boundaries – where two plates are moving apart. ...

Transform boundaries – where plates slide passed each other.

Explanation:

How much has the sea level risen between 1901 and 2010? a 7.5 feet b 7.5 inches c 12.6 inches d 2.5 feet

Answers

Answer:

From 1901 to 2010, global sea levels rose an estimated 187 millimeters (mm; 7.4 inches), averaging a 1.7 mm rise annually; estimates are that from 1992 to 2010, the rate increased to 3.2 mm annually.

huntington's disease is an autosomal dominant trait. given the pedigree below, if individual iv-2 has three children with a normal man, what is probability that exactly two of the three children would have the disorder?

Answers

There is a 50% probability that any kid born naturally to parents who have the Huntington's gene will also have the disease. It may be incredibly unsettling to live with the awareness that you are in danger.

How are individuals managing the sickness of Huntington's?

Huntington's disease has no known treatment and there is no way to prevent it from becoming worse. However, some of the issues it causes, such as those brought on by depression medications, mood swings, and involuntary movements, can be lessened with therapy and support. To assist in making daily duties simpler, occupational therapy.

A person just requires one copy of the unusual gene to acquire Huntington's disease because it is an autosomal dominant illness. A individual inherits two copies of each gene, with the exception of chromosomal genes.

Learn more about Huntington's disease

https://brainly.com/question/4275820

#SPJ4

All oil wells are drilled with a , a tool which bites into the rock and progressively deepens the hole. 6. The rock particles created by the drill bit are removed from the borehole and carried to the surface by the 7. What does the term spud in mean? 8. into the hole to keep the well walls from caving in. 9. wells determine the size and productive capacity of the oil reservoir. 10. The high temperature on the drill bit by the bit biting into rock was reduced by pumping through the bit.

Answers

The answers to the given questions are as follows:

All oil wells are drilled with the tool called a "drill bit."The rock particles created by the drill bit are removed by the "drilling mud" or "drilling fluid."The term "spud in" refers to the initial drilling of a well. The casing is inserted into the hole to keep the well walls from caving in.To reduce the high temperature on the drill bit caused by the bit biting into the rock, a process called "cooling" is employed.

The procedure used to build a well and bore tubes through the Earth's surface is known as oil drilling. The tube is attached to a pump, which forcibly removes the petroleum from underground.

Because oil and natural gas are found far below the earth's surface, drilling is a difficult procedure. To access fossil fuel resources, a hole must be drilled through the crust of the planet. After that, the oil must be safely pumped out of the oil well.

Steps of Oil Drilling:

The first step in oil drilling is to drill a hole through the crust of the earth. It requires a drill string and a long bit. A "drill bit" is the instrument used in oil wells to bite into the rock and gradually deepen the hole.A tiny diameter steel pipe is placed after drilling a hole, and the spaces surrounding it are filled with cement. This helps to keep the steel casing stable.In order to lubricate the spinning bit and clear the path of the shattered rocks, the drillers fill the hole with a mixture of solids, liquids, and chemicals, sometimes referred to as "mud," throughout the drilling operation. As the drill bit goes further, more pipes must be added to the drill string. To prevent the pipe connections from separating in the well, screws must be used.

Learn more about Oil Drilling from the given link:

https://brainly.com/question/31366794

what is stimuli ?? ​

Answers

Answer:

In physiology it is a detectable in the physical or chemical structure of an organism's internal or external environment.

Answer: In psychology, a stimulus is any object or event that elicits a sensory or behavioral response in an organism.  

Explanation:

which is not an abiotic factor that could affect a population?

Answers

Answer:

some important abiotic factors Space, water, and climate all help determine a species population.

Explanation:

Why isn't glycolysis considered a closed pathway?

Answers

Glycolysis is not considered a closed pathway because it consumes energy in the form of adenosine triphosphate (ATP) and generates energy in the form of adenosine diphosphate (ADP) and a high-energy phosphate group. Additionally, the intermediates of glycolysis, such as glucose and pyruvate, can be used in other metabolic pathways.

please I need help ! ​

please I need help !

Answers

the answer is A i thibk

Answer:

I think D.) More cobs on plants

Explanation:

If it ain D then it's C

What is light? Please respond in 1-2 complete sentences using your best grammar.

Answers

Answer:

In mine own answer, I think light is a source people use to see in the dark or for other reasons it's like something we need in life. Without light how would we live? Where does light come from? I feel like people ask this most of the time. How do we know what light is? All we probably know is that it's a source of light coming from some sort of powerful energy. So basically, light is a type of electromagnetic radiation that allows people to see more clearly in the dark.

Explanation:

Hope this helps!

What is Metabolism? In a simple answer.

Answers

Answer:

Metabolism is the process by which your body converts what you eat and drink into energy.

The alterations in an organism's or a cell's chemistry. The term metabolism broadly refers to the chemical processes that take place in an organism's cells to support life.

What is  Metabolism?

The word "metabolism" in a cell may be defined as all the chemical processes that take place within the cell to carry out all cellular tasks e.g., growth, development, and reproduction.

Anabolic processes, which often need an input of energy held in the chemical bonds of complex molecules, are distinguished from catabolic events, which typically entail the release of energy and the breakdown of bigger molecules into simpler ones.

These modifications generate the ingredients and energy that cells and organisms require to develop, procreate, and maintain health.

Therefore, metabolism broadly refers to the chemical processes that take place in an organism's cells to support life.

Learn more about metabolism, here:

https://brainly.com/question/29763323

#SPJ2

Researchers use a computer model to simulate an oil spill

in the ocean. The model predicts which areas of the

shoreline will be most impacted by an oil spill if it occurs in

a certain area.

What are two limitiations of this model?

A. It does not predict a situation that might cause an oil spill to

happen.

B. It does not show how each species of wildlife would be affected

by the oil spill.

C. It cannot be used to evaluate how an oil spill might affect multiple

areas of shoreline.

D. It does not show how an oil spill might spread from one area to

another

Answers

Researchers use a computer model to simulate an oil spill in the ocean. The model predicts C. It cannot be used to evaluate how an oil spill might affect multiple areas of shoreline. and D. It does not show how an oil spill might spread from one area to another.

Relying on the situation, oil spills may be very harmful to marine birds, sea turtles, and mammals, and also can damage fish and shellfish. Oil destroys the insulating capacity of fur-bearing mammals, which include sea otters, and the water-repelling abilities of a bird's feathers, exposing them to tough factors.

Oil spills can damage sea creatures, destroy an afternoon at the beach, and make seafood hazardous to consume. It takes sound technological know-how to ease up the oil, measure the effects of pollutants, and help the ocean recover.

Oil spills frequently show up because of injuries, when people make mistakes or equipment breaks down. other causes consist of natural screw-ups or deliberate acts. Oil spills have essential environmental and monetary outcomes. Oil spills also can have an effect on human health.

Learn more about oil spills here:-https://brainly.com/question/12558255

#SPJ1

Other Questions
which of the following descriptions of collateral ganglia is true? Question 3-7: How does the work done on the cart by the spring compare to its change in kinetic energy? Does this agree with your prediction? Is there a loss due to friction? How much? Two forces of 19. 8 pounds and 36. 5 pounds act on a body with an angle of 61. 4 degrees between them. On a coordinate plane, a vector on the x-axis is labeled 19. 8 pounds. A vector labeled 36. 5 pounds forms angle 61. 4 degrees with the x-axis. Choose the correct approximation for the magnitude of the resultant vector. 45. 5 pounds21. 3 pounds49. 2 pounds2416. 2 pounds Which statement best justifies whether (x+4) is a factor of the polynomial What is Prince Hamlet's reaction towards Claudius and Gertrude?. What was the most important meal for any class and came usually from 10:00 a.m.till noon Elizabeth Times Hello everyone I would like your help on this exercise because the physics I have a little difficulty. Here is the statement:A child launches a blue cart of mass m= 150 g in A of altitude zA= 0 on an inclined plane of an angle = 30 with respect to the horizontal. The cart then climbs to point C where it stops before descending in reverse. This blue cart is not subject to any frictional force between A and C.1-What are the forces acting on the car during its journey from A to C ?2-What can we say about the mechanical energy of the car? Why?3-Determine the velocity vA with which the child launches the cart in Asknowing that the point C is at the altitude zC= 0,80 mThe child then launches a red cart of the same mass as the blue one with a speed of 4.0 m/s. This car reaches only a height of 0.55 m.4-Show that the mechanical energy for this red car is not conserved.5-Assuming that the frictional force exerted on this car during all its journey is constant, calculate the work of this force noted f.6-Determine then the value of f.Data: Gravity field: g= 9,81 N/kg what would the area a large rectangle has side lengths of 8 centimeters and 7 centimeters. a small square with side lengths of 4 centimeters is cut out of the large rectangle. what is the electric flux through the surface shown in the figure? assume that e=340n/c. What prefit means beneath? dia- sur- dis- infra- Rosa has $16 in savings and will save all the money she earns from tutoring. She earns $6 per hour for tutoring. Which equation could be used to find the number of hours (r) Rosa must tutor to save exactly $100? * Identify the error in the following block of code.for x in range(2, 6): prnt(x)o The first line is missing quotes.o The first line has a spelling error.o The second line has a spelling error.o The second line needs to be indented four spaces. how do patents support free enterprise 6. You prepare biotinylated probes for use on Southern Blots using each strand of the 20 base pair denatured DNA molecule given below as templates. The labeling reaction includes DNA polymerase and a dNTP mix containing dTTP, dATP, dGTP and biotin labeled dCTP in the appropriate buffer. You are given 2 primers A and B that are designed to bind to the last 5 bases of each DNA strand in the correct orientation to generate a biotin labeled DNA strand. Primer A: 3'-CGACT-5'. Primer B: 5'-TAGTT-3' Template DNA 5'- TAGTTGCTCGCGACAGCTGA 3'- ATCAACGAGCGCTGTCGACT -3' - Assuming 100% incorporation of the biotin label, what percent of each probe (generated from each strand) would you expect to be biotinylated? Use the sequence size of the full length probe to calculate your answer. cool air inc., manufactures single room sized air conditioners. the cost accounting system estimates manufacturing costs to be $230 per air conditioner, consisting of 60% variable costs and 40% fixed costs. the company has surplus capacity available. it is cool air inc.'s policy to add a 30% markup to full costs. cool air inc., is invited to bid on a one-time-only special order to supply 110 air conditioners. what is the lowest price cool air inc. should bid on this special order? There are various indicators useful for the identification of domesticated animals in archaeological contexts, such asThe presence of such tools as plows and yokesThe presence of certain deformities and diseases among the animal remainschanges in animal DNAall of the above specify whether each of the items listed is hydrophilic or hydrophobic by dragging the labels into the appropriate box. Kelly bought 1 gallon of milk. If she has 1 cup of milk every day, how many days will 1 gallon of milk last? All of the following were part of American Economic policy during the 1920s EXCEPT: a.low taxesb.protections for businessc.high tariffsd.strict regulation of the economy Tell whether the fractions are equivalent. Write = or [tex]\neq[/tex] 3/4 ____ 8/12