The __________ nervous system mobilizes the body when one needs to exert tremendous energy (such as flee from an attacker).

Answer:

the correct answer is 6.

Answer:

The water should be omitted as a reactant or product to have a well-balanced equation only if the water reacts as a solvent.  

Explanation:

The water acts as a pure liquid and the increase of concentration of pure liquid is impossible. So, it is of no use when it acts as a solvent. As a product form water can be obtained as a liquid or gaseous substance. Their ability can increase the supply of hydrogen or oxygen to the reaction. When it is used as a main reactant it should be included.

As a role of solvent, it has no use in the chemical reaction. It has insignificant values as a role of solvent so it should be formatted while having the well-balanced equation. There are a lot of examples in which water is not included in the chemical reaction.

Explanation:

Answer:

D. Sistema reproductor.

Explanation:

La excreción es el proceso de eliminar los desechos y el exceso de agua del cuerpo. Estos desechos pueden ser dañinos y pueden causar daños.

Los órganos responsables de la excreción son el riñón, los pulmones, la piel, el hígado y el intestino grueso.

La piel elimina el sudor, el exceso de agua y las sales a través de las glándulas sudoríparas.

El sistema urinario está formado por riñón, uréteres, vejiga y uretra. El riñón elimina el exceso de agua y sal al producir orina que luego se transporta con la ayuda de los uréteres, la vejiga y la uretra.

En el sistema respiratorio, los pulmones excretan sustancias gaseosas, como dióxido de carbono y agua.

The statement: "Adenosine triphosphate (ATP) is considered the energy currency for the cell. This molecule is energy-rich, in part, due to its two phosphoanhydride bonds." is True

Adenosine triphosphate (ATP) is a molecule that serves as the primary energy currency for cells. It is used by cells to power many important biological processes, including muscle contraction, protein synthesis, and the transport of molecules across cell membranes. The energy that is stored in ATP is primarily located in its two phosphoanhydride bonds. A phosphoanhydride bond is a type of covalent bond that forms between two phosphate groups. In ATP, there are two such bonds that link the three phosphate groups together. When ATP is hydrolyzed, or broken down, one of the phosphoanhydride bonds is cleaved, releasing energy that can be used by the cell. This hydrolysis reaction produces adenosine diphosphate (ADP) and an inorganic phosphate (Pi) molecule. The released energy can be used to drive other chemical reactions in the cell or to do mechanical work, such as muscle contraction.

For more questions related to Adenosine Triphosphate, refer to:

https://brainly.com/question/14796956

#SPJ11

Cellular Respiration

Glycolysis and Krebs,

The powerhouse within our cells

To turn fuel into energy,

The power that never fails.

Pyruvate oxidation,

The breakdown of molecules

To create energy from glucose

And keep our cells in control.

The electron transport chain

Is the last step in respiration

Releasing energy from electrons

To keep our bodies in motion.

Photosynthesis

Plants take in the sun's light

Gathering energy for the night

Using carbon dioxide and water

To create sugar for a tight fight.

From light energy to chemical,

The energy is stored as glucose

Through a process of reactions

For the plants to use as fuel.

The Calvin Cycle is the main event

Using ATP and NADPH

To turn the newly created sugar

Into the energy we all need.

Answer:

telophase

Explanation:

I think its A because thast when it goes to the oppsite end ....I think

Answer:

Usually, parasites are much smaller than the host is, whereas predators could be either small or larger than the prey. Parasites have a very high reproduction rate but the predators reproduce slowly.

Explanation:

The correct answer is C. probably evolved from one single ancestral species from the mainland. Darwin realized that Finches differed form their relatives in mainland. The finches he saw were all particular on their own, so he concluded that their isolation from mainland and their insular habitat make them to evolve different traits, eventually each finch become a different species.

Answer:

D.

Explanation:

just took the test

Answer:

D

Explanation:

No explanation .

Answer:

Virus - A cold virus enters your body through your mouth, eyes, or nose. The virus can spread through droplets in the air when someone who is sick coughs, sneezes, or talks.

Explanation:

Fermentation operates in the absence of oxygen. The by-product formed in lactic acid fermentation is lactic acid and NAD+. Thus, option B is correct.

Fermentation is referred as a biochemical and metabolic process in which the substrate is broken down in the absence of oxygen. The energy liberated in this process is much lower than the energy released through aerobic respiration.

Fermentation is an industrially important process as it is helpful in the production of several beverages and wines. Various microbes are used in this process that carry out enzymatic reactions and undergo fermentation.

Fermentation is also crucial for baking industry. The bread, biscuits, cakes etc are manufactured through fermentation process. Baker's yeast (Saccharomyces cerevesiae) is widely used in this process.

Thus, fermentation is also important in the production of cheese, several antibiotics and drugs on a mass scale.

Learn more about fermentation, here:

https://brainly.com/question/13050729

#SPJ5

Answer:

It's the picture of the dolphins tale or fin, whatever it's called.

In this case answer B.

Explanation:

The leaf isn't used for motion.

The tail is moved up and down etc.. and creates motion that helps the dolphin swim.

The apple isn't used for motion.

The wolf's eye is used for sight, not motion.

Thus the answer is picture B.

The structure that is most likely used for motion is the tail fin of the fish. The correct option is B.

Motion is changing or modifying an object when applying a force. The living body move or locomote with the locomotion organ. These are different types of locomotion organs in different organs.

There are different organs in different animals for locomotion and motion. In humans there are legs, in animals there are paws and in fishes, there are fins, in insects, there are wings and legs.

There is no movement made by the leaf. The dolphin swims with the assistance of its tail, which is moved up and down and in other directions. It is not used to move the apple. The wolf's eye is for sight alone, not for movement.

Thus, the correct option is B. the tail fin of the fish.

To learn more about motion, refer to the below link:

https://brainly.com/question/12995374

#SPJ2

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

Symbiotic archaea that live inside tubeworms can use two different methods to metabolize hydrogen sulfide and can switch back and forth to accommodate fast-changing environmental conditions.

Symbiotic archaea that live inside tubeworms (specifically, deep-sea tubeworms) are known as sulfur-oxidizing bacteria. These bacteria have the ability to metabolize hydrogen sulfide, which is abundant in the deep-sea hydrothermal vent environments where the tubeworms reside. Hydrogen sulfide serves as an energy source for these bacteria, allowing them to generate the necessary nutrients for their survival.

The hydrothermal vent environments are highly dynamic, with fluctuating levels of hydrogen sulfide due to the venting of volcanic gases. To adapt to these fast-changing environmental conditions, the symbiotic archaea can switch between two different methods of metabolizing hydrogen sulfide. They can either use the sulfide oxidation pathway or the sulfur oxidation pathway, depending on the availability of hydrogen sulfide and other factors in their immediate environment.

This metabolic flexibility enables the symbiotic archaea to efficiently utilize the available resources and survive in the extreme and ever-changing conditions of deep-sea hydrothermal vents.

To know more about Symbiotic archaea click here:

https://brainly.com/question/1041169

#SPJ11

The given statement  " Synovial fluid is a viscous material that is derived by filtration from blood." is true  Synovial fluid is a thick, slippery substance found in the synovial joints, which are the most common type of joint in the body.

Synovial fluid is produced by the synovial membrane, which lines the inner surface of the joint capsule. The synovial membrane is made up of specialized cells called synoviocytes, which have a unique ability to filter and modify blood plasma to produce synovial fluid. This filtration process occurs through the capillaries found in the synovial membrane. The blood plasma is filtered, and certain components such as proteins, hyaluronic acid, and lubricin are added to create the viscous synovial fluid.

In summary, the statement that synovial fluid is a viscous material derived by filtration from blood is true. This process is carried out by the synovial membrane and its synoviocytes, which filter blood plasma and add specific components to create the lubricating and cushioning substance that is essential for the proper functioning of synovial joints.

To know more about synovial fluid click here

brainly.com/question/15458606

#SPJ11

The correct answer is E.) All of these statements about the post-absorptive state are correct. The state of the body between meals or while fasting is referred to as the post-absorptive state.

Amino acids are broken down to ketones, which can be used by the body's cells as an alternative source of fuel during the fasting/post-absorptive state. In addition to ketones, the brain may also use glucose generated by the liver from glycogen or other non-carbohydrate sources. However, some tissues, such as skeletal muscle, may break down protein into amino acids and use them for fuel. Fat cells break down triglycerides into fatty acids, which are also used as fuel by various tissues. During the fasting/post-absorptive state, the body makes use of its energy reserves to keep critical organs, such as the brain, functioning correctly. Many tissues, such as the brain, red blood cells, and the renal medulla, rely on ketones for energy. The body also takes steps to preserve its energy reserves during this time, such as reducing its basal metabolic rate. However, the body's energy stores can only last for a limited period, and eventually, it will need to refuel.

learn more about glycogen Refer: https://brainly.com/question/15356085

#SPJ11

Explanation:

Classification by characteristics of mosses and seed plants:

Mosses:

Seed plants

The major differences between mosses and seed plants are the facts that mosses reproduce using spores while seed plants use seeds and flower buds. Others include transportation of water by diffusion, reproduction with water and being small in size for mosses.

For seed plants, they transport of sugar through phloem, do not need water for reproduction and production of seed.

The correct question is:

Classify the characteristics as describing mosses or seed plants. Mosses Seed plants transport of water dependent on water transport of sugar by diffusion limited to small sizes for reproduction through phloem produce seeds independent of water for reproduction.

Learn more on mosses and seed plants here: https://brainly.com/question/13858749

#SPJ1

The advantage for plants having undigestible seeds is that it allows seeds to reside in the gut until conditions are appropriate for germination.

Fruits are a source of nutrition for animals that consume them, and they are also a means of seed distribution for plants that produce them. Many types of plants generate fruit that is consumed by animals; nevertheless, the seeds of such plants are usually indigestible. As a result, the seeds can be dispersed into new areas by animals that eat the fruit.

However, having undigestible seeds provides a distinct benefit to plants: it allows seeds to reside in the gut until conditions are appropriate for germination, which aids in seed growth and germination.

Learn more about  germination.

https://brainly.com/question/1675149

#SPJ11

Answer:

A. They have the same surface area, but model A has more volume.

Answer: D. They have the same volume, but model B has more surface area.

Explanation:

D water is plit ( H2O=H+&O2

Answer:

B.

Explanation:

A makes no sense since it says that pollution INCREASES human survival (lol), C says it has no effect, and D is plain strange.

Thus, B is the only one that makes sense.

Answer:

DNA contains the sugar deoxyribose whereas RNA contains the sugar ribose. DNA contains one less oxygen than ribose. DNA is double-stranded whereas RNA is usually single-stranded.

By mixing RNA-DNA, the researchers showed that it could have been possible to form a mixed molecule that could work as templates for RNA and DNA.

The two main types of nucleic acids are DNA and RNA.

Result of their interactions:

DNA-protein and RNA-protein interactions can have a profound effect on gene expression and the spatial and temporal localization of mRNA within a cell.

Learn more:

brainly.com/question/21992450

Answer:

nucleus

Explanation:

Answer:

nucleus

Explanation:

Enzymes are often used to make chiral products, but can be successfully used in some cases for achiral products.

The correct option is :- (c)

Enzymes are biological catalysts that can accelerate chemical reactions and are widely used in various industrial processes, including the production of chiral molecules.

Chiral molecules are those that possess asymmetry in their molecular structure, resulting in two or more mirror-image forms (enantiomers) that are not superimposable on each other.

Enzymes can be highly selective in their ability to recognize and interact with specific enantiomers, making them valuable tools for the production of chiral products such as pharmaceutical intermediates.

However, enzymes can also be used in some cases for the production of achiral products, which do not possess chirality. Enzymes can catalyze reactions involving achiral substrates, although they may have higher selectivity towards chiral substrates.

The use of enzymes in industrial processes for the production of both chiral and achiral products depends on the specific enzyme, substrate, and reaction conditions, and there are numerous examples of enzymes being used successfully in the production of both types of products.

To know more about  chiral products refer here :-

https://brainly.com/question/28259136#

#SPJ11

The step in excitation-contraction coupling in skeletal muscle indicated by "a" is the binding of acetylcholine (ACh) to nicotinic ACh receptors on the motor end plate of the muscle fiber.

Excitation-contraction coupling is the process by which an action potential in the muscle fiber membrane leads to muscle contraction. The process starts with the binding of ACh to nicotinic ACh receptors on the motor end plate. This binding leads to depolarization of the muscle fiber membrane, which spreads throughout the muscle fiber via the T-tubules.

Next, the depolarization of the T-tubules triggers the release of Ca2+ ions from the sarcoplasmic reticulum (SR) into the cytoplasm of the muscle fiber. These Ca2+ ions bind to troponin, which is part of the thin filaments in the muscle fiber, causing a conformational change in the troponin-tropomyosin complex. This conformational change exposes the binding sites on actin for myosin, allowing myosin to bind to actin and initiate muscle contraction.

Therefore, step "a" in excitation-contraction coupling is the binding of ACh to nicotinic ACh receptors on the motor end plate of the muscle fiber, which triggers depolarization of the muscle fiber membrane and initiates the procExcitation-contraction coupling is the process by which an action potential in the muscle fiber membrane leads to muscle contraction. The process is initiated by the binding of acetylcholine (ACh) to nicotinic ACh receptors on the motor end plate of the muscle fiber, which triggers depolarization of the muscle fiber membrane. This depolarization spreads throughout the muscle fiber via the T-tubules, which are invaginations of the muscle fiber membrane that penetrate deep into the interior of the muscle fiber.

The depolarization of the T-tubules triggers the release of Ca2+ ions from the sarcoplasmic reticulum (SR) into the cytoplasm of the muscle fiber. The SR is a specialized organelle in the muscle fiber that stores Ca2+ ions. When the depolarization of the T-tubules reaches the SR, it triggers the opening of Ca2+ channels on the SR, allowing Ca2+ ions to flow into the cytoplasm of the muscle fiber.

These Ca2+ ions then bind to troponin, which is part of the thin filaments in the muscle fiber. Troponin is a complex of three proteins that is bound to tropomyosin, another protein that lies along the actin filaments. The binding of Ca2+ ions to troponin causes a conformational change in the troponin-tropomyosin complex, which exposes the binding sites on actin for myosin. Myosin is a motor protein that interacts with actin to generate force, and its binding to actin initiates muscle contraction.

Overall, the process of excitation-contraction coupling is a complex sequence of events that involves the conversion of an electrical signal (the action potential) into a mechanical response (muscle contraction). It involves the coordinated action of many different proteins and organelles within the muscle fiber, and it is essential for the proper functioning of skeletal muscle.

To know more about excitation-contraction coupling.

https://brainly.com/question/28139662

#SPJ11

The affect the Life cycle in gas sensor are the environmental conditions, the type of gas, the concentration of gas, and the sensor's design,

Gas sensors have a crucial role in modern society and have numerous applications, they are widely used to detect toxic and flammable gases, which makes them essential for maintaining safe environments. Gas sensors have a life cycle that is influenced by several factors. The life cycle of a gas sensor can be defined as the total time a sensor works accurately before failing. The main factors that affect the life cycle of a gas sensor include the environmental conditions, the type of gas, the concentration of gas, and the sensor's design.

Environmental factors such as temperature, humidity, and other physical and chemical conditions, affect the sensor's life cycle. The type of gas and the concentration of gas affect the life cycle of a gas sensor by contributing to the chemical reactions that take place on the sensor's surface. In summary, the life cycle of gas sensors can be affected by different environmental and operational factors, and understanding these factors is crucial in designing gas sensor systems that are reliable and efficient.

Learn more about humidity  at:

https://brainly.com/question/30415486

#SPJ11

Long protein strands that are transported to the site of a wound to form a web that traps blood cells and forms a clot are called fibrin.

Fibrin is an essential component of the blood clotting process, helping to prevent excessive bleeding and promote wound healing.

When a blood vessel is damaged, a series of events known as the coagulation cascade is initiated. This cascade involves a complex sequence of reactions that ultimately lead to the formation of a blood clot. Fibrinogen, a soluble protein present in the blood, is converted into fibrin through the action of the enzyme thrombin.

Fibrin molecules then assemble into long, insoluble strands that form a mesh-like network at the site of the injury. Platelets and red blood cells get trapped within this fibrin mesh, forming a stable clot. The clot acts as a physical barrier, preventing further blood loss from the damaged blood vessel.

Over time, the clot undergoes remodeling and is eventually dissolved through a process called fibrinolysis, allowing for tissue repair and restoration of normal blood flow. The formation and subsequent dissolution of fibrin clots are tightly regulated processes that ensure appropriate clotting at the site of injury while maintaining overall blood flow throughout the body.

Learn more about clot here:

https://brainly.com/question/1501224

#SPJ11