Answer:
These:
Explanation:
behavior of alligators
black holes
deep sea vents
the Aurora Borealis
Any event or an occurrence that happens on its own without any human intervention is termed as a natural phenomena.
Natural phenomena harms the nature as well as life on earth.
Common examples of natural phenomena include thunder storms, earthquakes, landslides, volcanic eruptions, hurricane etc.
Some majestic natural phenomena include blood rain, Northern lights and luminous water in the world.
Natural phenomena can sometimes be destructive in nature and are therefore responsible for loss of lives and property.
It is almost impossible to predict the occurrence of any natural phenomena.
However, the negative outcome of natural phenomena can be managed with special disaster management operation
Thus, natural phenomena could only be observed and understood in science.
Learn more about natural phenomena, here:
https://brainly.com/question/28585198
#SPJ2
What is the per capita growth rate of the global human population?
A.) negative
B.) fluctuating
C.) positive
D.) zero
Answer:
positive
Explanation:
The global human population has been steadily increasing in size for hundreds of years.
ANSWER FAST PLEAAASEEE
Because killer whales are at the top of many food chains, it may seem as if they are not at risk of starving if seals die off. Why is this not necessarily true?
Answer:
This is not true. Although they eat sharks, whales, and dolphins, that is just occasional. Seals are their primary meal.
Sorry it was late
Hope this helps!
1. The following gene sequence appears on one strand of a segment of DNA that is about to go
through DNA Replication. What code will DNA Polymerase build to make the complementary
strand?
TACGGCATATGCAAATGGCGAGCCTATATT
The DNA polymerase will build the complementary strand with the code: ATGCCGTATACGTTTACCGCTCGGATATA.
What is DNA replication?DNA replication is a process by which a DNA molecule makes a copy of itself. During DNA replication, an enzyme called DNA polymerase reads the existing DNA strand and builds a new complementary strand by matching up the appropriate nucleotides.
To build the complementary strand of DNA, we need to use the base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).
So, for each base in the original sequence, we will pair it with its complement:
Original strand: TACGGCATATGCAAATGGCGAGCCTATATTComplementary strand: ATGCCGTATACGTTTACCGCTCGGATATALearn more about DNA Replication here: https://brainly.com/question/21265857
#SPJ1
The complementary strand to the given sequence would be:
ATGCCGTATACGTTTACCGCTCGGATATAA
What is gene sequence?A gene sequence is a specific sequence of nucleotides in DNA (or RNA) that encodes the genetic information for a particular trait, function or protein. Genes are the basic unit of heredity and are responsible for passing on traits from one generation to the next.
The complementary strand of DNA will have a sequence that pairs each nucleotide with its complementary base: adenine (A) with thymine (T), and cytosine (C) with guanine (G). Therefore, the complementary strand to the given sequence would be:
ATGCCGTATACGTTTACCGCTCGGATATAA
During DNA replication, DNA polymerase reads the existing strand from 3' to 5' and builds the complementary strand in the 5' to 3' direction. Therefore, the new strand would be synthesized by adding nucleotides in the following order:
ATA...CGT...TAA...CGC...TGG...ATA
Learn about complementary strand here https://brainly.com/question/1534778
#SPJ1
List at least four factors that
determine the type of vegetation
that occurs in a terrestrial
biome.
Pleaseeee help
Answer:
Differences in temperature or precipitation determine the types of plants that grow in a given area (Figure 1). Generally speaking, height, density, and species diversity decreases from warm, wet climates to cool, dry climates. Raunkiaer (1934) classified plant life forms based on traits that varied with climate.
Explanation:
Help me fast please guys thanks!!!!!!!
Answer:
The answer is cattle ranching for beef and leather products.
Explanation:
cattle ranching doesn't require trees. You don't use trees to feed the cattle.
Questions
Which of the following is a feature seen in viruses as well as cellular organisms?
Genetic information in the form of nucleotide sequences in a nucleic acid genome?
1-Genetic information in the form of amino acid sequences in a protein genome
2- Plasma membrane always present
3-A protein capsid always present
4- Ability to carry out cellular respiration and gene expression independently
retu bratswap
5026
A
Answer:
Genetic information in the form of amino acid sequences in a protein genome
Maggie places cells of Elodea, a freshwater plant, on a wet-mount microscope slide. She uses a saltwater solution to prepare the slide. When she observes the cells under the microscope, what is she most likely to see?
A.
The cell walls have dissolved, releasing the cell.
B.
The cells have remained unchanged.
C.
The cells will swollen, expanding the cell walls.
D.
The cells have shrunk within the cell walls.
When Maggie places the cells under the microscope, she is most likely to see D. The cells have shrunk within the cell walls.
Why would the cells have shrunken ?If Maggie places cells of Elodea, a freshwater plant, on a wet-mount microscope slide, and then uses a saltwater solution to prepare the slide, she is most likely to see the cells have shrunk within the cell walls when she observes them under the microscope.
When cells are placed in a hypertonic solution (such as saltwater), water moves out of the cells by osmosis, resulting in the cells losing water and shrinking. In the case of Elodea cells, the cells will shrink within the cell walls.
Find out more on cells at https://brainly.com/question/13047140
#SPJ1
A mutation causes a sequence of DNA that has the nucleotides TTG to be changed to TCG. The resulting protein has a different sequence of amino acids. Which type of mutation is this?
Answer:
subtitution mutation
Explanation:
The T in the middle is subtituted with C.
Hope it helps.
Answer:
The answer is A, missense.
Explanation:
Why is photosynthesis considered a light-dependent reaction?
1. It requires sunlight as an energy source.
2. It needs sunlight to break apart important molecules.
3. It depends on sunlight to warm the plant.
4. It requires sunlight as a catalyst.
Photosynthesis is a light-dependent reaction because light is used as a catalyst in this process. With the help of the light, the water molecule breaks; that is the first step. Option 4 is correct.
What is photosynthesis?Photosynthesis is a process that requires sunlight. The sunlight acts as a catalyst as it falls on the chlorophyll pigment and breaks down the water molecules. Due to the breakdown of water molecules, the electron passes.
This process uses water and carbon dioxide to produce glucose and oxygen. Water is broken down at the PSII complex, and then the electron moves to the PSI. Through this electron movement process, a proton gradient is formed that helps in ATP production.
The carbon dioxide is fixed in the stroma, and it is a light-independent reaction. The water is oxidised to form oxygen, and carbon dioxide is reduced to form glucose.
Hence, sunlight acts as a catalyst. Option 4 is the correct answer.
Click here to learn more about photosynthesis.
https://brainly.com/question/1388366
#SPJ2
2 pts Although most biologists do not consider viruses to be alive, viruses do share some characteristics with living things. Which of the following is the requirement for life that viruses lack? The ability to move The ability to reproduce on their own Having genetic material Having highly ordered structure Question 30 2 pts While they are simple relative to cells, viruses often have a very diverse collection of components. Which one of the following choices is LEAST likely to be found as part of a virus? membrane components ribosomes proteins with functional binding sites single-stranded DNA glycoproteins Although most biologists do not consider viruses to be alive, viruses do share some characteristics with living things. Which of the following is the requirement for life that viruses lack? The ability to move The ability to reproduce on their own Having genetic material Having highly ordered structure Question 30 2 pts While they are simple relative to cells, viruses often have a very diverse collection of components. Which one of the following choices is LEAST likely to be found as part of a virus? O membrane components O ribosomes O proteins with functional binding sites single-stranded DNA O glycoproteins
Viruses are considered to be non-living entities because they cannot carry out metabolic processes or reproduce on their own. Instead, they rely on the host cells they infect to provide them with the necessary machinery to replicate themselves.
However, viruses do possess genetic material, either DNA or RNA, and they have a highly ordered structure.
One requirement for life that viruses lack is the ability to reproduce on their own. They require a host cell to reproduce and cannot do so independently. This is because they lack the machinery necessary to carry out the complex processes involved in reproduction, such as DNA replication and protein synthesis.
While viruses are simple compared to cells, they often have a diverse collection of components. They typically have a protein coat, or capsid, that encloses their genetic material. Some viruses also have an envelope composed of membrane components, including lipids and glycoproteins, which they acquire from the host cell during the process of budding. Viruses do not have ribosomes, as they do not carry out protein synthesis themselves, but they may have proteins with functional binding sites, such as enzymes that aid in the process of replication.
Of the choices listed, single-stranded DNA is least likely to be found as part of a virus. While some viruses do have DNA as their genetic material, it is typically double-stranded, and RNA is also a common viral genome. Single-stranded DNA is more commonly found in certain types of bacteria-infecting viruses known as bacteriophages.
Learn more about viruses here:
https://brainly.com/question/30428438
#SPJ4
2. ______ are made up of at least one cell. Which word best fits in the blank? * 1 point A. Animals B. All living things C. Plants D. Atoms
Living things are made up of at least one cell which is option B.
Living things explained.
Living things are organisms that have one or more cells and have life i.e they can breathe.
Living things are organisms that can perform some essential processes and has the ability to maintain their internal environment.
Some essential processes perform by living things are metabolism, respiration and so on.
The mature characteristics of living things are movement, respiration, nutrition, irritabilility, growth, excretiuon, reproduction and death.
Examples of living things are plants and animals.
Therefore, living things are composed of one or more cells and have a complex organization that help them to maintain their internal environment.
Learn more about living things below.
https://brainly.com/question/280237
#SPJ1
Which of the following best illustrates evidence from comparative anatomy that
supports biological evolution?
Explanation:
our ancestors turning into humans that have evolved today
developing countries tend to have high birth rates. why?
Answer:
In developing countries children are needed as a labour force and to provide care for their parents in old age. In these countries, fertility rates are higher due to the lack of access to contraceptives and generally lower levels of female education
Explanation:
PLEASE HELP! 50 pts!!!!!
Answer each question individually
4. The graph below shows the population of a species over time.
a) Label four parts of the graph:
Exponential growth
Maximum growth
Carrying capacity
Growth slowing down
(I put a pic of the graph that’s to be labeled)
b) Why does growth slow down?
c) what are the conditions for exponential growth?
Answer:
a)
exponential growth- from begining to end(not sure about this one)
maximum growth- -around the middle where line is going almost straight up (where the most increase of pop. happening)
growth slowing down-right before hitting the capacity
carry capacity - dotted line on top
b)the growth slows down as it hits is carrying capacity, it's essentially slowing down to get ready to stop (like a car slowing down before a stop)
c) conditions might be a surplus of food and water, lack of predation, little to no threats, etc
Explanation:
The diagram below represents a stack of rock layers. Examine the diagram, and answer the question that follows.
What do these layers and their fossils suggest about Earth's history?
A.
There have been changes in Earth's lifeforms over time.
B.
Lifeforms on Earth have been the same over time.
C.
No lifeforms were present when these layers formed.
D.
Only one kind of lifeform lived where these layers formed.
Fossils are animals and vegetable remains that get deposited or printed in sedimentary layers. Option A is correct: There have been changes in Earth's lifeforms over time.
What is a fossil?
Fossils are animal and vegetable rests found in different strata of sedimentary rocks. Sedimentary layers deposit chronologically, so they are used to reflect history. They keep in each layer some of the forms of life that inhabited that area in the past.
Fossils are very useful while dating ages. Index fossils are the fossilized organizms that only used to exist in a given era or geological period during evolution.
Fossil registers show that similar or different structured have been inhabiting the same area in the same period of time.
According to this framework, we can assume option A is correct: There have been changes in Earth's lifeforms over time.
In the image, from the bottom (oldest layers) to the upper part (most recent layers), we can see how the organisms inhabiting this area changed with the pass of time.
You can learn more about fossils at
https://brainly.com/question/14988327
#SPJ1
Based on what you've read, answer the following questions.
1. Girls generally begin their growth spurt with a major hormonal shift called the
2. The hormone that causes the growth of pubic and underarm hair in girls is
3. Most
don't understand that adults have experienced the same kinds of things
they re experiencing.
4. According to Erik Erikson, adolescents face the crisis of
5. Most people express more than
identity.
6. What factor--parents, peer groups, or youth culture has the greatest effect on the educational and vocational choices of teenagers?
7. Two eating disorders associated with young women and adolescents are
and
8. The abused substances that are most used by adolescents are
and
9. Most sexually transmitted diseases are
Explanation:
secondary character structure
Which is NOT a function of the muscular system?
A. sensing the environment
B. balance
C. generating heat
D. circulation
Answer:
A is the answer
plz give me a brainest
Sensing the environment is not a function of the muscular system. Thus Option A is correct.
What are the major function of muscular system?A system which act like a machine by converting chemical energy from food into mechanical energy to enable various physiological activities of body.
Three types of muscles present in the body. A consciously controlled skeletal muscles attached to bones and causes movement of those bones to do various activities like running, chewing.
An involuntary Smooth muscle present inside the blood vessels like the stomach, help in movement of food and blood circulation.
An involuntary Cardiac muscle resides in heart stimulates contractions leads to generation of heartbeat.
Some major function of this system include movement, support, providing stability, maintain posture of body, blood circulation, respiration due to diaphragm muscle, digestion, urination etc.
Hence, option A is correct.
Learn more about muscular system, here:
https://brainly.com/question/3162365
#SPJ2
Cellular Respiration: describe each set of chemical reactions. Make sure to include the reactants, products, and location where each step occurs.
Answer:
n,,,,,,xdwe
Explanation:
The dark bands seen under the microscope in a skeletal muscle fiber are concentrations of actin protein called l-bands . It is true or false.
Answer:
it is false
Explanation:
it appears as light bands under microscope
Answer:
false
Explanation:
because dark band seen under the microscope in a skeletal muscle fiber are concentration of actin protein are known as A bands because they are anisotropic when viewed with polarized light
To determine whether regulation of gene expression by short RNAs was a naturally occurring phenomenon, researchers isolated RNA from a cell and fractionated them by size to obtain only short RNAs. The next step was to clone these molecules.
Today the cloning step would not be required. Which of the techniques below is the best reason why?
A. Because a microarray could tell if the fragments were encoded by the genome.
B. Because a PCR reaction could tell if the fragments were encoded by the genome.
C. Because an RNA-seq reaction could tell if the fragments were encoded by the genome.
D. Because a yeast 2 hybrid could tell if the fragments were encoded by the genome.
E. Because a GFP fusion could tell if the fragments were encoded by the genome.
Answer:
C. Because an RNA-seq reaction could tell if the fragments were encoded by the genome.
Explanation:
The combination of single-cell RNA sequencing (RNA-Seq) and bioinformatic tools to assemble and annotate sequence reads is currently the most common methodology used to obtain complete transcriptomes from individual cells. RNA-seq is a Next-Generation Sequencing (NGS) technology that enables the analysis of the entire transcriptome, thereby this method can be used to examine gene, allelic and ncRNA expression. In the last years, RNA-seq has become the gold standard technique for direct analysis of ncRNA expression profiles in biological samples and clinical research.
inguinal lymph nodes are found in
At what pH levels are enzymes in the human body productive?
Answer:
Between ph7 and ph 11
Explanation:
The optimum pH level for this is at pH7 because the number achieved was 350 product molecules per Minute
SOMEONE HELP ME PLEASE PLEASE JUST ZOOM UP ON THE PICTURE IT’S DUE TODAY PLEASE I NEED HELP
Answer:
A blue whale is not equipped to lift objects as it is a mammal adapted for living in the ocean. They are the largest animals on Earth and can weigh up to 200 tons, but they have no muscles in their fins to lift objects. They primarily use their fins for swimming and maneuvering in the water
Explanation:
In which life stage do humans start to talk, read, and
write?
Answer:
In Stage 1 (initial reading, writing and decoding), typically between the ages of 6 and 7 years old, the child is learning the relation between letters and sounds and between print and spoken words.
Hope it helped!!!
Answer:
In Stage 1 (initial reading, writing and decoding), typically between the ages of 6 and 7 years old, the child is learning the relation between letters and sounds and between print and spoken words
What is the minimum internal temperature for holding hot food to
prevent harmful food borne pathogens from multiplying?
Describe the difference in pressure against your cheeks when they are full of air versus When You released it
Answer: When they were full of air, then the Pressure was the Highest 'cause of the larger force under the specified area as compared to when we released it. We decreased the area of our cheek, so pressure increased and air flows from the cheek (area of high pressure) to the atmosphere
Explanation:
What is the most important influence of the forest ecosystem on the environment
Answer:
Forests
Explanation:
Forests have also sanitary influences upon environment due to the production of oxygen through photosynthesis.
The study of the environment is called ecology. There are two types of factors for an ecosystem and these are a biotic and abiotic factors.
The correct answer is light
What is photosynthesis?The process of the formation of food by trapping the sunlight with the help of chloroplast is called photosynthesis.
According to the question, the most influential factor which affects the environment is light as all the plants directly depend on the light for the formation of food and all the other species are dependent on plants either directly or indirectly.
Hence, the correct answer is light.
For more information about the light, refer to the link:-
https://brainly.com/question/1388366
If 98 out of 200 individuals in a population express the recessive phenotype, what percent of the population would you predict to be homzygous dominant?
Answer:
49% is the answer for this question
Which of the following concepts makes it legally right to reproduce a substantial portion of the works of another person with permission?
The concept that makes it legally right to reproduce a substantial portion of the works of another person with permission is Copyright. Option A
What is copyright all about?The concept of copyright grants the creator of an original work the sole rights to its use and distribution, usually for a limited time, with the intent of enabling the creator to receive compensation for their intellectual effort.
When someone else wishes to reproduce a substantial portion of those works, they must usually get permission from the copyright holder.
This permission can take the form of a license or contract that outlin the tems under which the work can be used.
The above answer is in response to the full question below;
Which of the following concepts makes it legally right to reproduce a substantial portion of the works of another person with permission?
A. Copyright
B. Fair use
C. Freedom of information
D. Intellectual freedom
Find more exercises on Copyright.;
https://brainly.com/question/13800858
#SPJ1
Please answer the following 4 questions regarding genetics.
Answer:
1. Carol is heterozygous for hemophilia. Her husband does not carry the allele for hemophilia. What is the probability that they will have a daughter with hemophilia? A son with hemophilia?
Solution:
Since Carol is heterozygous for hemophilia, she has one X chromosome with the hemophilia allele and one X chromosome without the hemophilia allele. Her husband, who does not carry the allele, has one X chromosome without the allele and one Y chromosome.
The probability that they will have a daughter with hemophilia is 0, as the daughter would need to inherit the hemophilia allele from both parents, which is not possible in this case.
The probability that they will have a son with hemophilia is 50%, as the son will inherit the hemophilia allele from Carol (who passes one of her X chromosomes to her son) and the Y chromosome from his father.
2. Jake suffers from red-green colorblindness. He married Janet who is not colorblind nor a carrier. What is the probability that they will have a daughter with color blindness? A son with colorblindness?
Solution:
Jake suffers from red-green colorblindness, which means he has a recessive allele for the condition on his X chromosome. Janet is not colorblind nor a carrier, which means she has two normal X chromosomes.
The probability that they will have a daughter with color blindness is 0, as the daughter would need to inherit the recessive allele for color blindness from both parents, which is not possible in this case.
The probability that they will have a son with color blindness is 50%, as the son will inherit the recessive allele for color blindness from Jake (who passes his X chromosome to his son) and a normal copy of the X chromosome from Janet.
3. William suffers from hemophilia. He married Sandra who is a carrier of the trait. What is the probability they will have a son with the disorder?
Solution:
William has hemophilia, which means he has a recessive allele for hemophilia on his X chromosome. Sandra is a carrier of the trait, which means she has one normal X chromosome and one X chromosome with the hemophilia allele.
The probability that they will have a son with hemophilia is 50%, as the son has a 50% chance of inheriting the hemophilia allele from Sandra (who passes one of her X chromosomes to her son) and a 50% chance of inheriting the Y chromosome from William.
4. Which of the following could be the parents of a colorblind female?
a) A normal male and a normal female (not a carrier)
b) A normal male and a female carrier
c) A colorblind male and a normal female (not a carrier)
d) A colorblind male and a female carrier
Solution:
A colorblind female can only occur if she inherits the recessive allele for color blindness onboth of her X chromosomes. Therefore, the only possible parents of a colorblind female are a colorblind male and a female carrier (option d).
Option a is not possible because both parents are normal and do not carry the color blindness allele. Option b is not possible because the female carrier would need to pass on the recessive allele for color blindness to the daughter, which is not possible as the daughter would inherit a normal X chromosome from the father. Option c is not possible because a normal female cannot carry the recessive allele for color blindness.
Hope this helps!
For any recessive disease to occur it is necessary that both the recessive alleles are expressed in the individual. 1) probability of a hemophilic daughter is 0 and a son is 50%. 2) Probability of a color-blind son is 50% and a daughter is 0. Hemophilic son - 50 %. 4) Option D is correct.
1) The probability that they will have a hemophilic daughter is zero. This is because to express the hemophilic trait one allele of the trait must be inherited from both the parents, but here the mother is a carrier while the father does not carry any allele for the disease.
The probability that they will have a hemophilic son is 50%. This is because he will inherit an X chromosome from his mother who is a carrier of the disease and one Y chromosome from his father.
2) The likelihood of having a color-blind daughter is 0 because the daughter would have to inherit the color-blind recessive allele from both parents.
The likelihood of having a color-blind son is 50% because the son inherits the color-blind recessive allele from Jake (through his X chromosome) and the normal X chromosome from Janet.
3) The likelihood of having a hemophiliac son is 50% because the son inherits 50% of the hemophilia gene from Sandra (passing one of her X-chromosomes to the son) and 50% of the Y-chromosome gene from William.
4) A colorblind woman can only become a colorblind woman if she has a recessive gene for color blindness in both her X-chromosomes. So, the only parents of a female who is colorblind are male and female carriers of the recessive gene.
To learn more about probability, refer to the link:
https://brainly.com/question/30034780
#SPJ2