PLZ help expressions

PLZ Help Expressions

Answers

Answer 1

Answer:

7r = 5

Step-by-step explanation:

Answer 2

Answer:

The answer is 7r = 5

Step-by-step explanation:

Hope this helps

btw have a wonderful day!


Related Questions

Can someone help?- I will mark brainliest !!

Can someone help?- I will mark brainliest !!

Answers

It is proportional by 2/3 because if you put y/x and simplify the fraction you get that each fraction is simplified to 2/3 which means they are proportional. I hope this helps. If not make a comment and ask.
2/3, you can tell by the y divided by x and simplify it

Simplify:

–13.5a + 34.12b + 65.5a – 32.5b – 35.8a
A. 32.5a + 20.47b
B. 16.2a + 1.62b
C. –18.7a – 26b
D. 1.62a + 16.2b need the answer right away

Answers

Answer: 32.5a + 20.47b

Step-by-step explanation:

Answer:

It's A

Step-by-step explanation:

edg 2022

please help me answer

please help me answer

Answers

Answer:

You would do the division first.

256 / 16 = 16

so, we have to determine 80 -16 +8

equals 72

Step-by-step explanation:

Answer:

The answer is 56

Step-by-step explanation:

To answer the equation, you must do the order of operations. Which is PEDMAS.

P= Parenthesis

E= Exponents and Radicals

M= Multiply

D= Divide

A= Add

S= Subtract

Always multiply, divide, add or subtract from left to right.

Because the equation is: 80 - 256 ÷ 16 + 8.

Your equation should be:

80 - 256 ÷ 16 + 8

= 80 - 16 + 8

= 80 - 24

= 56

I hope this helps! I'm sorry if it's wrong or complicated.

The scientist reduces the temperature by 3.5 °C on Tuesday. Select the equations that show the new temperature in °C.

Answers

Answer:

Can you give us some more information so we can help u out

Step-by-step explanation:

Yes we need the answer options

For 8 weeks, Melanie will receive $600 and a new computer. After only 6 weeks of work, she would be entitled to the new computer but only an additional $150.

PLSSSS HELPPP SHOW WORK AND TELL ME HOW

Answers

Answer:

Step-by-step explanation:

'For 8 weeks, Melani will receive $600 and a computer.'. In other words, Melanie will receive $600 dollars each of the 8 weeks. 'After only 6 weeks of work, she would be entitled to the new computer but only an additional $150. '

8 take away 6 is 2 weeks, Melanie will receive only 2 weeks of an additional $150. And 6 weeks with no additional pay. $600 divided by 8 is $75, this is the amount she'll necessarily get for all of the 8 weeks.

600 divided by 8 is $75, to find out how much she made in 6 weeks we'll have to times 6 (representing 6 weeks) with $75, which equals $450.

That is in other words, $450, she earned in 6 weeks WITHOUT additional pay.

To calculate what she earned in ADDITIONAL pay we need to know how much she earned in 2 weeks. 2 (representing 2 weeks) times $75 is 150. Plus the additional $150 which will be divided up in 2 weeks is 75$. So she'll be earning `$150 each of the 2 weeks.

PS.....I'm not exactly clear of what the question is.

Two positive integers have a product of 240 and a GCF of 2.
What are all of the possibilities for these pairs of numbers.

Answers

Answer: 2 possibilities

Step-by-step explanation:

WILL GIVE BRIANLEST PLS HELP NOW

WILL GIVE BRIANLEST PLS HELP NOW

Answers

10. 48
11. negative 16

What is the approximate solution of the system?

What is the approximate solution of the system?

Answers

do not open that thing above

why is the graph wrong ​
and how would a fixed one look like

why is the graph wrong and how would a fixed one look like

Answers

Answer:

It's wrong because they are being paying $3 each day so it would be $3, $6, $9, $12, $15, $18 and so on. Not $5, $8, $11, and $14.

It's wrong because they are being paying $3 each day so it would be $3, $6, $9, $12, $15, $18 and so on. Not $5, $8, $11, and $14.

Multiply the pairs of numbers and match them with their products. Tiles (-5)(4.2) (-7)(-3) (4) (5) (2.5)(-9) Pairs 22.5 21 -22.5 -21 111

Answers

Here are the pairs matched with their products:

- (-5)(4.2) matches with -21

- (-7)(-3) matches with 21

- (2.5)(-9) matches with -22.5

Pairs (4) and (5) do not have corresponding products in the given options.

The products of the given pairs of numbers are:

(-5)(4.2) = -21

(-7)(-3) = 21

(4)(5) = 20

(2.5)(-9) = -22.5

So, the pairs of numbers and their products are as follows:

(-5)(4.2) = -21 matches with -21.

(-7)(-3) = 21 matches with 21.

(4)(5) = 20 matches with 20.

(2.5)(-9) = -22.5 matches with -22.5.

I hope this helps!

Simplify the expression:
10z+5z+2z

Answers

The simplified expression is 17z

i have alot of work to do so this would make me go faster if u help me with this question In the picture

i have alot of work to do so this would make me go faster if u help me with this question In the picture

Answers

I think it’s $1.35 sorry if I’m not correct
I’m pretty sure 1.35

Answer ASAP! but only if you know 100%, and whoever gets it right can have brainliest
beinggreat78, please confirm or answer this question

Answer ASAP! but only if you know 100%, and whoever gets it right can have brainliestbeinggreat78, please

Answers

hey there! to find the area of a circle all you need is the radius!

the formula is: A = π r²
by plugging in the value(s) we were given, 28.274 is your final answer.

who ever can fingure this out both of these pages will be mark brainyest of all

who ever can fingure this out both of these pages will be mark brainyest of all
who ever can fingure this out both of these pages will be mark brainyest of all

Answers

Answer:

First Page

multiplying

1.95 + (-10)

the order of operations

Second Page

numerical

solve

divide

left

Step-by-step explanation:

1.95 + 10 doesn’t matter the order u get it right

Which list orders the numbers from least to greatest?

Negative 2.4, negative 1.5, negative 2 and one-fourth, negative 3, negative 1 and one-eighth

A number line going from negative 4 to positive 4.
Negative 1 and one-eighth, negative 1.5, negative 2 and one-fourth, negative 2.4, negative 3
Negative 3, negative 2.4, negative 2 and one-fourth, negative 1.5, negative 1 and one-eighth
Negative 3, negative 2 and one-fourth, negative 2.4, negative 1 and one-eighth, negative 1.5
Negative 1.5, negative 1 and one-eighth, negative 2.4, negative 2 and one-fourth, negative 3

Answers

Negative 3, negative 2.4, negative 1.5, negative 2 and one-fourth, negative 1 and one-eighth


Hope my answer helps you✌️

Negative 3, negative 2 and one-fourth, negative 2.4, negative 1 and one-eighth, negative 1.5 is the list that orders the numbers from least to greatest.

Which answer choice represents an equivalent number sentence that uses the distributive property to rewrite "8(5+9)"?
A. 85 + 89
B. 8(5) + 8(9)
C. 8(14)
D. 112

Answers

It would be c because you would add (5+9) to get 14 and then multiple it by 8. So 8(14) but that’s the answer if it just wants you to rewrite it
The answer is 112 if they want you to solve it
8(14)is the answer of your question

A project will take a total of 720 person-days to complete. If the project must be completed in 30 days, how many people must be employed? PLEASE HURRY

Answers

Answer:

192 hours per day / 8 hours per person per day = 24 people

Step-by-step explanation:

Assuming each person works for 8 hours a day, the total number of hours needed to complete the project is:

720 person-days x 8 hours = 5,760 hours

To complete the project in 30 days, the total number of hours needed per day is:

5,760 hours / 30 days = 192 hours per day

It’s 24!! EXPLAIN-720/30=24 because you have to divide the amount of people by days p/d= e

DID YALL KNOW THERES A LION KING 2

Answers

Answer:

answer: wait for real? whens it coming out?

Answer:

Did not know.

Is it out yet?

Drag each tile to the correct box.
Dominic is a server at a restaurant. Each dish at the restaurant costs $8. A sales tax of 8% is charged. The total bill amount includes the sales tax of the meal.

Dominic earns tips left by customers. The amount of money tipped can be represented by a percentage of the total bill.

Order the tip amounts from least to greatest tip, in dollars.

5 dishes
17.5% tip

6 dishes
14% tip

7 dishes
11% tip

4 dishes
20% tip

Answers

Answer:

In this order is least to greatest:

1. 4 dishes-20% tip

2. 6 dishes -14% tip

3. 7 dishes-11% tip

4. 5 dishes-17.5% tip

Order the tip amounts from least to greatest tip will be $6.65, $6.91, $7.25, and $7.56.

What is the percentage?

The amount of any product is given as though it was a proportion of a hundred. The ratio can be expressed as a quarter of 100. The phrase % translates for one hundred percent. It is symbolized by the character '%'.

The percentage is given as,

Percentage (P) = [Final value - Initial value] / Initial value x 100

Dominic is a server at a restaurant. Each dish at the restaurant costs $8. A sales tax of 8% is charged. The total bill amount includes the sales tax of the meal.

The amount of tip for all the orders, then we have

A. 5 dishes and 17.5% tip, then the tip cost is given as,

⇒ ($8 x 5) x (1.08) x (0.175)

⇒ $7.56

B. 6 dishes and 14% tip, then the tip cost is given as,

⇒ ($8 x 6) x (1.08) x (0.14)

⇒ $7.26

C. 7 dishes and 11% tip, then the tip cost is given as,

⇒ ($8 x 7) x (1.08) x (0.11)

⇒ $6.65

D. 4 dishes and 20% tip, then the tip cost is given as,

⇒ ($8 x 4) x (1.08) x (0.20)

⇒ $6.91

Order the tip amounts from least to greatest tip will be $6.65, $6.91, $7.25, and $7.56.

More about the percentage link is given below.

https://brainly.com/question/8011401

#SPJ2

Solve the equation r = 1/(x-1) for x in terms of r. In other words, manipulate the equation until you have x equal to an expression with r's in it but no x's.

Answers

Answer:

\(x=\frac{1}{r} +1\)

Step-by-step explanation:

\(r=\frac{1}{x-1}\)
\(r(x-1)=1\)
\(x-1=\frac{1}{r}\)
\(x=\frac{1}{r} +1\)

Answer:

\(x=\dfrac{1+r}{r}\)

Step-by-step explanation:

Given equation:

\(r=\dfrac{1}{(x-1)}\)

Multiply both sides by (x - 1):

\(\implies r(x-1)=\dfrac{1}{(x-1)} \cdot (x-1)\)

\(\implies r(x-1)=1\)

Expand the brackets:

\(\implies rx-r=1\)

Add r to both sides:

\(\implies rx-r+r=1+r\)

\(\implies rx=1+r\)

Divide both sides by r:

\(\implies \dfrac{rx}{r}=\dfrac{1+r}{r}\)

\(\implies x=\dfrac{1+r}{r}\)

Use the distance formula to write an equation of the parabola with focus F(0, -13) and directrix y=13

y=?

(FINALEXAM)

Use the distance formula to write an equation of the parabola with focus F(0, -13) and directrix y=13y=?(FINALEXAM)

Answers

Answer:

-1/52 x^2

Step-by-step explanation:

4p(y-k)=(x-h)^2

4(-13)y=x^2

-52y=x^2

y=-1/52 x^2

NEEDS TO BE ANSWERED TODAY!!!!Order from least to greatest (turn them into decimals) a.) 104% b.)\(\sqrt{7}\)c.) -\(\frac{3}{5}\)d.)-1

Answers

Answer:

abcdefghijklmnopqrstuvwxyz

NEEDS TO BE ANSWERED TODAY!!!!Order from least to greatest (turn them into decimals) a.) 104% b.)[tex]\sqrt{7}[/tex]c.)

Answer:

104% ~1.04 b.)2.65 c.) -0.6 d.)-.01

Answer. -1, 3/-5, 104%, v7

Please help me out on this It would mean a lot. Needed by tomorrow please.

Please help me out on this It would mean a lot. Needed by tomorrow please.

Answers

Answer: x-2 =4

Step-by-step explanation:

First of all you want to undo the multiplication. So what ever you do to one side you do to the other so divide 5 from both sides and you get x-2=4

Answer:

The answer for x-2=4

x=4+2;x=6

Step-by-step explanation:

5(x-2)=20

divide both sides by t

5(x-2)/5=20/5

(x-2)=4

x=4+2=6

A natural history museum surveyed the people visiting the museum for one month and created a circle graph to show the age of the visitors for that month.
Plzz I need the answers for A
a. Find the number of degrees for each part of the museum visitors graph. (8 points)
Age 18 and under:
Age 19 – 44:
Age 45 – 64:
Age 65 and over:
b. If 5000 people visited the museum during the month the survey was taken, how many visitors were there for each age group? (8 points)
Age 18 and under:
Age 19 – 44:
Age 45 – 64:
Age 65 and over:

Answers

Answer:

a. Age 18 and under: 54

Age 19 – 44: 126

Age 45 – 64: 108

Age 65 and over: 72

b. Age 18 and under: 750

Age 19 – 44: 1,750

Age 45 – 64: 1,500

Age 65 and over: 1,000

Can I have the brainliest, please?

Can 5, 2, 4 be the measures of the sides of a triangle?

Answers

Answer: Yes

Step-by-step explanation:

In order to form a triangle, the sum of two sides must be GREATER than the third side.

a + b > c    &      a + c > b      &     b + c > a

5 + 2 > 4    &      5 + 4 > 2     &     4 + 2 > 6

    True                  True                   True

The sides 5, 2, 4 satisfy the rules for forming a triangle.

Lakiesha is fly a kite the string is 29 feet long and the height of the kite is at 20 ft her dog is currently underneath the kite what is the distance between lakiesha and her dog

Answers

Answer:

35.23 ft

Step-by-step explanation:

Answer:

35.23ft

Step-by-step explanation:

i need help First 1 to answer they get brainllyest and 50 points

i need help First 1 to answer they get brainllyest and 50 points

Answers

Answer:

B

Step-by-step explanation:

I think is B because is in the same line

Line TK is not a transversal to line. LR because lines TK and LR are parallel, transversal lines intersect.

Answer is C

A company published 100 books last year, of which 9 were best-sellers. What percent were best-sellers?

Answers

Answer:

9% of the 100 were best-sellers

Step-by-step explanation:

there are 100 books, and 9 of them were best sellers, to put this in a percentage we can do (9/100)*100 which gives us 9, we slap a % on it and get 9%

9% of a 100 were best sellers

Find an equation of the line that passes through the points (2,6) and (-4.6). Write the equation in slope-intercept form.

Find an equation of the line that passes through the points (2,6) and (-4.6). Write the equation in slope-intercept

Answers

Answer:

change in y /change in y to get the gradient . therefore (6--6)=12  and (2--4)=6 thus 12/6=2 that the gradient.

Step-by-step explanation:

form the equation ion form of y=mx+c

and thus the equation y= 2x+c

if you take one point coordinate  such as (2,6)

such that y=6 and x=2 thus the equation will be

6=2*2+C

6=4+C

C=6-4=2

therefore  answer is  

Y=2X+2

Answer:

Y=2X+2

Step-by-step explanation:

What number is represented by point A?

A number line going from 0 to 1. There are 4 equal spaces between 0 and 1. Point A is on the mark to the left of 1.

One-fourth
One-third
Three-fourths
Four-thirds

What number is represented by point A?A number line going from 0 to 1. There are 4 equal spaces between

Answers

Answer:

3/4 or Three-fourths

Step-by-step explanation:

1. The number 'A' is between 0 and 1, indicating that its a fraction.

2. We see that there are 4 spaces between 1 and 0.

3. 'A' is on the third space.

Therefore, the number will be marked space/total no. of spaces

(If you find it confusing, try a few similar questions for practice.)

Hope it helps :)

Pls considering giving this a gud rating n marking it the brainliest <3

3/4! 4 ticks going from the first tick to “1” so the answer is 3/4
Other Questions
Would a drug that acts by disrupting the nuclear envelope (the double membrane surrounding the nucleus) be effective for treating bacterial infections presenyt perfecht from eat Calculate the grams of ethane present in a sample containing 0.8286 moles if the molar mass of ethane is 30.067 g/mol. When 3a? 7a+ 6 is subtracted from 4a? - 3a +4,the result is cules son los tres casos para clasificar el lenguaje discriminatorio? As a student in a lab, you are provided DNA with the sequence that is shown below. Your mentor asks that you design DNA primers to amplify the bold and underlined region of the DNA by PCR. Provide the 10 nucleotide sequence of the primers that you would design and indicate the 5 and 3' ends of each primer. (1) ATTGTATCCGCATTTGATGCTACCGTGGTTGAGTCAGCGTCGAGCACGCGGCACTTATTGCATGAGTAGAGTTGA CTAAGAGCCGTTAGATGCCTCGCTGTACTAATAGTTGTCGACAGATCGTCAAGATTAGAAAACGGTAGCAGCAT TATCGGAGGTTCTCTAACTAGTATGGATAGCCGTGTCTTCACTGTGCTGCGGCTACCCATCGCCTGAAAACCAGTT GGTGTTAAGCGATCCCCTGTCCAGGACGCCACACGTAGTGAAACAT What is the Tm and annealing temperature? (1) SName:Adverbs and Adjectives WorksheetDirections: Circle the correct form to complete the sentence.1. The student wanted to finish her homework quick/quickly2. Todd walked very sneaky sneakily down the hallway.3. The student was in such a hurry that she did bad/badly on the assignment.4. The girl sang beautiful beautifully5. The classroom was very noisy/ noisily.6. Antonio wound up and threw the football hard / hardly7. Whoever made the cake did a wonderful / wonderfully job.8. She was running down the hallway crazy / crazily9. She answered the question wrong / wrongly10. The flowers smelled good / well Which of the following was not a reason for making the sepoys of the East India Company rebellious?The efforts of the officers of the Company to spread ChristianityThe order to the sepoys to travel on shipsThe stoppage of BhattaThe inefficiency of the officers None of the above/More than one of the above I'm ready to appreciate. Please describe every detail pleaseShow that Let measure of ACR be 0. Then measure of the set {x: EA} be 0 Every detail as possible and would appreciate 2Select the correct answer.A community center has an L-shaped swimming pool that is 10 feet deep. What is the volume of the pool?10 ft.6 ft.20 ft.16 ft.10 ft. Anyone can help me out with this question real fast? .................................................. So, the expression 10 + 2p - 3r10+2p3r10, plus, 2, p, minus, 3, r equals 333 when p = 4p=4p, equals, 4 and r = 5r=5r, equals, 5. How do you search Brainly answers?. A rectangular sheet of metal measures 8 inches by 10 inches. The metal is worth $5.00 persquare inch. How much is the sheet of metal worth? Calculate the value of ZL in the given circuit in order for Z_ to receive maximum average power. What is the maximum average power received by ZL? Assume 1, = 9 290 A. -;102 2 30 22 40.8232 2012 The value of ZL is 0. The maximum power received by Zis W why can the pku screening test be performed earlier on infants on formula compared with breast-fed babies? how does the function of poly-a polymerase differ from rna polymerase? plz help quick. the sum of two numbers is 11. Three times the first number minus the second number is -3. what are the numbers? What effect did the leak of the dobbs draft opinion have on abortion rights??