Please select the word from the list that best fits the definition

The worship of many gods

Here are the words:
Polytheism
Epics
Silt
Chariot
Surplus
Architecture
Empire
Priests
Cuneiform
Fertile Crescent
Pictographs
Scribe
Alphabet
Rural
Irrigation
Ziggurat
Impact
Monarch
Role
Canals
Division of labor
Social hierarchy
City-state

Answers

Answer 1
polytheism is the worship/practice of multiple gods/higher powers :)
Answer 2

Answer:

polytheism

Explanation:

i rlly need brainlist


Related Questions

How does the following excerpt from paragraph 9 contribute to the author's version of the Thanksgiving story?: "The Pilgrims were not in good condition. They were living in dirt-covered shelters, there was a shortage of food, and nearly half of them had died in the winter"?



A

It reminds the reader that the American frontier was a dangerous place, especially during the winter.

B

It demonstrates why the Pilgrims needed help from Squanto.

C

It reveals that the Pilgrims needed to learn more about the poisonous plants in the area.

D

It shows that if the Pilgrims had worked harder they would not have needed Squanto's help.

Answers

Answer:

Explanation:

Squanto was not mentioned in the quotation. That eliminates B  and D. They did not die from poisonous plants. They died of starvation and likely inadequate housing. So C is gone.

All you are left with is A, which you likely would have picked anyway.

Malaria is considered to be an endemic disease because it __________. A. is life-threatening B. is generally spread by mosquitoes C. is commonly found only in tropical climates D. has no available vaccine Please select the best answer from the choices provided A B C D

Answers

Answer:B

Explanation:

I took the quiz

Answer:

The answer would be C. is commonly found only in tropical areas.

Explanation:

If you would have looked up the word endemic you would have found this.  

(of a disease or condition) regularly found among particular people or in a certain area.

"complacency is endemic in industry today"

Thus the answer is C.

In 1868, a conservative resurgence known collectively as the ___________ _________________ began in earnest in the South.

Answers

In 1868, a conservative resurgence known collectively as the "Redeemers" began in earnest in the South. The Redeemers were a coalition of Southern Democrats and former Whigs who sought to regain political power in the aftermath of the Civil War and Reconstruction.

They were primarily motivated by a desire to roll back the gains made by African Americans during Reconstruction, including voting rights and other civil liberties.

The Redeemers employed a variety of tactics to achieve their goals, including violence, intimidation, and voter suppression. They also worked to establish a system of segregation and Jim Crow laws that would keep African Americans in a position of inferiority for decades to come.

Despite their efforts, the Redeemers faced significant opposition from both Northern Republicans and African Americans themselves. The struggle for civil rights in the South would continue for many years, with victories and setbacks along the way. Today, the legacy of the Redeemers and their efforts to maintain white supremacy remains an important part of American history and an ongoing issue for many communities across the country.

Learn more about  conservative resurgence  here:

https://brainly.com/question/32438879

#SPJ11

We demand that the amount of circulating medium be speedily increased to not less than $50 per capita meaning

Answers

We urge a swift rise in the amount of circulating medium to at least $50 per person.

Real Gross Domestic Product (GDP) per Capita is the average amount of national income per person (adjusted for inflation); to find real GDP per capita, divide real GDP by the population of the nation. Be sure to quickly raise the circulating medium to at least $50 per capital.

Real median personal income for 2019 was $35,977. In America, there are many people who are incredibly wealthy, hence the mean is significantly higher. The nominal GDP of a nation is first adjusted for inflation by dividing the nominal GDP by the deflator to produce the real GDP per person, or per capita.

Learn more about GDP.

https://brainly.com/question/30111703

#SPJ4

Many Europeans were looking to ________________ with China and Japan

Answers

wanted to control trade with Asian countries

According to Kipling, what is the white man’s burden?

Answers

Answer:

Kipling believed the "White Man's burden" was the duty of white men to bring education and salvation to people around the world that he deemed uncivilized. Many people, including people of color and anti-imperialists, have called this concept racist.

Explanation:

#carry on learning

in 1854, senator douglas introduced a bill to set up a government in the nebraska territory based on popular sovereignty. congress then compromised with the kansas-nebraska act, which divided the region into two territories. what problem did some northerners have with the kansas-nebraska act?

Answers

Some northerners opposed the Kansas-Nebraska Act primarily because it made it permissible for the Kansas and Nebraska territories to open for slaves. Since 1820, the Missouri Compromise has stopped this from occurring.

The Kansas-Nebraska Act was passed in 1854 by Illinois senator Stephen A. Douglas to organise the Nebraskan territory. His major objective was to build a railroad that would cross through Kansas and Nebraska on its way from Chicago to San Francisco.

The territories of Kansas and Nebraska were established by the Kansas-Nebraska Act of May 30, 1854, which also unlocked fresh regions.

Due to their concern that the Kansas-Nebraska Act might legalise slavery in Northern territories, several Northerners in Congress opposed and rejected it. Douglas clarified this matter by saying that it should be up to the inhabitants of such regions to decide whether or not slavery is acceptable inside their borders.

Visit here to learn more about Kansas-Nebraska Act: https://brainly.com/question/15753593

#SPJ4

PLEASE HELP ITS MY LAST DAY
Why is it difficult for an oppressive government to enforce a policy of digital censorship?

Select all that apply.

The information on government websites is too confusing to read.
Internet anonymity makes it difficult to track the sources of leaks.
All people have to sleep, but the Internet is a 24-hour operation.
The Internet’s design reads blockage as damage and self-corrects.

Answers

Answer:

B. and D. are the answer! Good luck with your exams

Internet anonymity makes it difficult to track the sources of leaks

--

The internet's design reads blockage as damage and self-corrects

What region was most impacted by the Great Famine?

Answers

Answer:

hey !

The region that was most impacted by the Great Famine refers to the Irish Potato Famine, which occurred in the mid-19th century in Ireland. The Great Famine had a devastating impact on Ireland, particularly on the rural population heavily dependent on potato crops for food and livelihood. It resulted in widespread famine, mass starvation, disease outbreaks, and significant population decline.

While the Great Famine affected various parts of Ireland, some regions experienced more severe consequences than others. The western and southwestern parts of Ireland, including counties such as Mayo, Galway, Clare, and Kerry, were among the hardest hit. These areas had high concentrations of small-scale tenant farmers who relied heavily on potato cultivation as their primary source of sustenance.

The vulnerability of these regions was compounded by factors such as dependence on a single crop, the prevalence of poverty and land inequality, and the impacts of British colonial policies on land ownership and agriculture. As a result, the Great Famine's impact was most acutely felt in these predominantly agricultural regions, where the loss of the potato crop had catastrophic consequences for the population.

hope that answers your question! :)

Answer: northern Europe the gut below beat me to it

Explanation:

Which item was invented in 1972 by minnesota vikings field-goal kicker fred cox?.

Answers

The Nerf Football was invented in 1972 by Minnesota Vikings Kicker, Fred Cox

Which of the following is a major difference between appellate courts and courts of first instance? A. Appellate courts do not use a jury, only judges. B. Courts of first instance hold appellate jurisdiction exclusively. C. Courts of first instance do not use judges and appellate courts do. D. Appellate courts hear all criminal and civil cases and courts of first instance do not.


i will give brainliest :)​

Answers

Answer:

A:

Appellate courts do not use a jury, only judges.

Explanation:

I took the quiz

Answer:

a

Explanation:

which u.s. president came into office in 1809 and tried to form a deal with france and great britain to cease their attacks?

Answers

James Madison came into office in 1809 and tried to form a deal with France and Great Britain to cease their attacks.

James Madison used coercion and force as President to acquire West Florida. During the first year of Madison's presidency, the United States forbade trade with both Britain and France. However, in May 1810, Congress approved trade with both, instructing the President to deny trade with either country if it refused to accept American views on neutral rights. Madison backed Jefferson's choice to engage in a naval conflict with Barbary Pirates. When both France and Britain started abusing U.S. neutrality rights during the Napoleonic Wars, it posed a serious foreign policy dilemma. Jefferson and Madison intended to sign a new treaty with Britain that would safeguard American economic rights and outlaw impressment because they were particularly outraged by the British impression of American seamen. When they failed to secure these concessions, they decided to press the European countries through economic sanctions.

To know more about James Madison

brainly.com/question/9602091

#SPJ4

explain effect of land enclosure movement on peasant farmers in britain?{10 mks}please help gys

Answers

Answer:

fence off their lands

Explanation:

Do we have free will ???

Answers

Yes, every human and organism ever made has what is called Free Will

Even though they are detained in Dachau, Elizar and his bunkmates are determined to at least observe the Passover. They smuggle in a few supplies and arrange for one of the prisoners to say the Kiddush, or blessing. For what reason does the senior block captain likely refrain from joining in when the men hold their makeshift Passover?

A.
Most senior block captains were Aryan so he would not be interested in Passover.

B.
The senior block captain must not have felt worthy to participate because he worked with SS.

C.
The senior block captain was probably standing as a lookout while the Passover was observed.

D.
In the case that the SS later asked, he would most likely want to deny his involvement.

Answers

A most senior block captains were aryan but not sure I want my points

Answer:

A is the answer, I just took the test

Explanation:

Who were the barbarians during the time of Ancient Rome?a. The Greeksb. Roman citizens who worked on the farm or in the minesc. It was the Roman name for slaves or gladiatorsd. People groups living outside the Roman Empiree. All of the above

Answers

People groups living outside the Roman Empire were the barbarians during the time of Ancient Rome. The correct answer is d.

During the time of Ancient Rome, the term "barbarians" was used to refer to people who lived outside the boundaries of the Roman Empire and who were considered uncivilized by Roman standards. These people groups were often seen as a threat to the security and stability of the Roman Empire, and the Romans frequently engaged in military campaigns to subdue them and expand their territory.

The Greeks were not considered barbarians by the Romans, as they had a rich cultural and intellectual tradition that was highly respected by the Romans. Roman citizens who worked on farms or in mines were not considered barbarians either, as they were part of the Roman society and culture.

The correct answer is d.

To know more about barbarians, click here.

https://brainly.com/question/14046016

#SPJ4

Private property is protected by
A enforceable contracts
B the federal reserve
C the security exchange commission
D the federal trade commission

Private property is protected byA enforceable contractsB the federal reserve C the security exchange

Answers

Answer:

C. The security exchange commission

B2: How has the South's role in the GATT/WTO changed over time? Why did LDCs become more actively involved in the GATT Uruguay Round, and what has been their position in the Doha Round? (5 marks)

Answers

The South's role in the GATT/WTO has evolved over time, reflecting changing dynamics in the global economy and trade landscape. The GATT (General Agreement on Tariffs and Trade) was established in 1947 with the goal of promoting free trade and reducing barriers to international commerce. Initially, the South, which includes developing countries, had a limited role in the GATT negotiations.

However, as the global economy became more interconnected, the South's involvement in the GATT/WTO increased. One significant change occurred during the Uruguay Round of GATT negotiations, which took place from 1986 to 1994. The LDCs (Least Developed Countries) became more actively involved in these negotiations. They recognized the potential benefits of liberalizing trade and sought to participate in shaping the rules governing international trade.

The LDCs' increased involvement in the Uruguay Round was driven by several factors. Firstly, they realized that trade liberalization could provide them with opportunities for economic growth and development. By participating in the negotiations, they aimed to secure favorable terms that would address their unique challenges and enable them to integrate into the global economy more effectively.

Overall, the South's role in the GATT/WTO has evolved over time, with developing countries actively participating in negotiations and advocating for their interests. The LDCs, in particular, have sought to leverage these platforms to address their development needs and secure favorable conditions for trade.

Learn more about LDCs with the given link,

https://brainly.com/question/19506267

#SPJ11

What act by the British was the final straw for the colonists? *

Answers

Answer:

the tea act

Explanation:

Answer:

\(\huge\boxed{The\:Tea\:Act}\)

Explanation:

The Tea Act was one of the final measures passed by Parliament in the years before the Revolutionary War.

Hope it helps!<3

What act by the British was the final straw for the colonists? *

The important contribution to navigation made by eratosthenes in the third century bc was __________.

Answers

The important contribution to navigation made by Eratosthenes in the third-century bc was a reasonably accurate calculation of the circumference of our planet.

Who is Eratosthenes?

Eratosthenes was born in 276 BC and died in 194 BC.  He was a well-known poet, mathematician, a researcher in geography, and theorist of music. He was the first to gauge the size of the planet.

The Earth was first measured by Eratosthenes of Cyrene. The precise measurement of Earth's circumference was greatly aided by Eratosthenes' work in the third-century bc.

As a result, the Eratosthenes in the third century bc accurate calculation of the Earth.

Learn more about Eratosthenes, here:

https://brainly.com/question/1995686

#SPJ4

1. Which green card eligible category received the most
applicants?

Answers

Answer: Family…you’re welcome :)

to pay the largest criminal fine in history and why

Answers

The largest criminal fine ever paid is by BP, which had to pay $4 billion in 2012 as a result of the Deepwater Horizon oil spill.

The Deepwater Horizon oil spill, which occurred on April 20, 2010, was an explosion and subsequent fire on the Deepwater Horizon semi-submersible Mobile Offshore Drilling Unit (MODU), which resulted in the loss of 11 lives and the release of an estimated 4.9 million barrels of crude oil into the Gulf of Mexico.

The explosion caused the Deepwater Horizon rig to sink, causing significant environmental damage to marine life and coastal communities in the Gulf of Mexico. In 2012, BP agreed to pay a total of $4.5 billion to resolve all criminal and civil charges related to the spill, including $4 billion in criminal fines and penalties. The $4 billion criminal fine was the largest criminal fine ever paid.

To know more about criminal fine, refer to the link below:

https://brainly.com/question/33443712#

#SPJ11

Which native american tribe refused to trade or deal with the french?

Answers

Answer:

When the French lost the war in 1763 and surrendered their colonies in North America, the Abenaki had no European allies left to help them deal with British demands for their land.

Explanation:

Which statement about Tenochtitlan is not correct?
O a. Tenochtitlan's neighborhoods were organized according to the inhabitants' wealth and status.
O b. Compared to Paris or Venice, Tenochtitlan was a small, rural village.
O c. The city boasted clean streets, markets, and a zoo.
O d. All sorts of goods and services could be found at the city market called Tlateloco.

Answers

Explanation:

from a rectangular street of cardboard of size 75 m/ 50 m r cut for squares of side 8 m from each corner find the area of lift cardboard

latin american term for nineteenth-century local military leaders

Answers

The Latin American term for nineteenth-century local military leaders. The term you are looking for is "caudillos." Caudillos were influential military and political figures who held significant power during the nineteenth century in Latin America. They typically rose to power through military might and charisma, often establishing control over regions or entire countries. Caudillos were known for their strong, authoritative leadership and their ability to maintain order through force.

The rise of caudillos in Latin America was primarily due to the power vacuum that emerged following the collapse of Spanish colonial rule in the region. As new, independent nations struggled to establish stable governments, charismatic military leaders stepped in to fill the void. Some famous caudillos include Juan Manuel de Rosas in Argentina, Antonio López de Santa Anna in Mexico, and José Antonio Páez in Venezuela.
While the rule of caudillos often brought about short-term stability, their regimes were typically marked by authoritarianism and a lack of democratic institutions. This, in turn, contributed to the region's long-term political and economic instability.

know more about Latin American terms.

https://brainly.com/question/12012636

#SPJ11

What does Martin say is the only cure for hate and fear?

Answers

Martin Luther King Jr. believed that the only cure for hate and fear is love.

In his speeches and writings, he consistently emphasized the transformative power of love and nonviolence in overcoming injustice and achieving social change. According to King, hate and fear can only be effectively countered by responding with love and understanding.

He famously stated, "Darkness cannot drive out darkness; only light can do that. Hate cannot drive out hate; only love can do that." King advocated for a philosophy of love and nonviolence as a means to confront oppression and discrimination. He believed that love has the ability to break down barriers, heal divisions, and create a more just and equitable society.

King's message of love was rooted in his deep commitment to justice and equality. He saw love as an active force that requires action, empathy, and compassion. By advocating for love as the antidote to hate and fear, King inspired countless individuals to engage in peaceful resistance, promote understanding, and work towards a world where all people are treated with dignity and respect.

To learn more about Martin Luther King Jr., click here:

https://brainly.com/question/15213495

#SPJ11

How did European diseases affect Americas

Answers

Answer:

Europeans carried a hidden enemy to the Indians: new diseases. ... Diseases such as smallpox, influenza, measles, and even chicken pox proved deadly to American Indians. Europeans were used to these diseases, but Indian people had no resistance to them. Sometimes the illnesses spread through direct contact with colonists.

Answer:

the population of the indians decreased because most of them died because of diseases such as chicken pox (not only diseases) that european settlers brought with them

What is a agrarian economy??

Answers

Answer:

An agrarian society, or agricultural society

Explanation:

it is a comunity that its economy is based on producing and harvesting crops

How is having an electoral college different than having direct
elections?

Answers

When citizens cast their ballots for president in the popular vote, they elect a slate of electors. Electors then cast the votes that decide who becomes president of the United States. Usually, electoral votes align with the popular vote in an election.


Hopes it helps you.

After the Khmer Rouge took control of Cambodia in 1975, people were murdered by the regime or starved to death. 10 million 5 million 2 million 1 million

Answers

After the Khmer Rouge took control of Cambodia in 1975, about 2 million people were murdered by the regime or starved to death.

The Khmer Rouge is a term used to describe the political party that ruled Cambodia from 1975 to 1979. They were a radical communist group led by Pol Pot. During their four-year reign, they were responsible for the deaths of around two million people.How were people murdered by the Khmer Rouge?The Khmer Rouge regime had a goal of creating a classless society. They wanted to eliminate all people they believed were opposed to this goal. As a result, they targeted intellectuals, professionals, artists, and religious leaders. They established concentration camps, where they forced people to do hard labor. Many died of overwork, starvation, and disease. Many more were executed for their political beliefs.

The Khmer Rouge regime also targeted ethnic minorities. They believed that the Vietnamese, Chinese, and other non-Cambodian groups were threats to their goal. The Vietnamese, in particular, were subject to extreme violence. Approximately 1.5 million Vietnamese were expelled from Cambodia, and thousands more were killed in forced marches across the border.

To know more about starved visit:-

https://brainly.com/question/21806411

#SPJ11

Other Questions
Name and give one fact about each of the 8 planets that helps set it apart from theothers. change the following number to polar form and then divide. Express the result in rectangular form and polar form. Check your answer by dividing the originanumbers in rectangular form4/3+5i List three examples of figurative language in chapter 3 of Night and explain what the author is really trying to tell his readers Find the solution of the system of equations shown on the graph As a student in a lab, you are provided DNA with the sequence that is shown below. Your mentor asks that you design DNA primers to amplify the bold and underlined region of the DNA by PCR. Provide the 10 nucleotide sequence of the primers that you would design and indicate the 5 and 3' ends of each primer. (1) ATTGTATCCGCATTTGATGCTACCGTGGTTGAGTCAGCGTCGAGCACGCGGCACTTATTGCATGAGTAGAGTTGA CTAAGAGCCGTTAGATGCCTCGCTGTACTAATAGTTGTCGACAGATCGTCAAGATTAGAAAACGGTAGCAGCAT TATCGGAGGTTCTCTAACTAGTATGGATAGCCGTGTCTTCACTGTGCTGCGGCTACCCATCGCCTGAAAACCAGTT GGTGTTAAGCGATCCCCTGTCCAGGACGCCACACGTAGTGAAACAT What is the Tm and annealing temperature? (1) B.Give another name for plane CC. Name three collinear points:D. Name a line segment:E. Name the ray that is opposite AD: which of the following hardcore bands hailed from washington, d.c.? Joey works in a candy store. He has a 15.73-pound bag of gummy fish candy that he needs to split among 11 jars. If he could split the gummy fish evenly, how many pounds would he put in each jar? Argument assay The topic: Is online education effective?Pls Select the correct answer. (PLATO)A cross-section of a tree trunk shows 20 dark-colored rings and 20 light-colored rings. What is the likely age of this tree? A. 20B. 40C. 10 If 2.50 mol of copper and 5.50 mol of silver nitrate are available to react by single replacement, identify the limiting reactant Can someone help with my English essay: write an informative essay on Greek mythical character your essay will use reasearch to summarize the plot of the myth and explain the mythical characters cultural significance snap:jacob.savege a craterlike lesion that occurs in the lining of the stomach or duodenum is called: How is the city alive? In the city we became the post for Nancy's gazebo form a regular hexagon what is the measure of the angle formed at Each corner of the gazebo Sophia is selling boxes of Girl Scout cookies. For every 20 boxes she sells, she raises $15 for charity. If Sophia has a goal of raising $60, how many boxes of cookies does she need to sell? Use the number line to solve. * Which institution did alexis de tocqueville see as an important exception to americas egalitarianism? by which process does air move into the lungs? if 5x+2y=20 and y=10, what is 3x? The human cost of WWI was 5 million casualties. 15 million casualties. 30 million casualties. 40 million casualties.