need to be done asap!!! I will give u brainliest if ur right

Need To Be Done Asap!!! I Will Give U Brainliest If Ur Right

Answers

Answer 1
The answer is the first one, A

Related Questions

is my answer correct?

is my answer correct?

Answers

Answer: B. Graph on the top right

The correct answer is B, which is the graph on the top right.

Step-by-step explanation:

Hope this helps =)

For the following point in polar coordinates, determine three different representations in polar coordinates for the point. Use a positive value for the radial distance r for two of the representations and a negative value for the radial distance r for the other representation. (675) Two different representations using a positive value for r are 6 and 6 ). One representation using a negative value for ris ). Submit Question Question 9 B0/1 pt 100 3 4 Details to Cartesian coordinates. 37 Convert the polar coordinate 5, Enter exact values. y = Question Help: Worked Example 1 Submit Question Question 10 0.5/1 pt 95-994 Details

Answers

The radial distance r = 6 and the angle θ = 75°. Representation 1: (r = 6, θ = 75°). Representation 2: (r = -6, θ = 75°). Representation 3: (r = 6, θ = 255°).

To represent a point in polar coordinates, we use the radial distance r and the angle θ.

Given the point (675), we have the radial distance r = 6 and the angle θ = 75°.

To find three different representations, we can vary the radial distance r by using both positive and negative values while keeping the angle θ constant.

Representation 1: (r = 6, θ = 75°) - This is the given representation.

Representation 2: (r = -6, θ = 75°) - Here, we use a negative value for the radial distance r while keeping the angle θ the same.

Representation 3: (r = 6, θ = 255°) - To find a different representation, we add 180° to the given angle θ. This results in a point with the same radial distance but in the opposite direction.

These three representations provide different ways to express the same point in polar coordinates, using different combinations of positive and negative values for the radial distance.

To learn more about radial distance click here:

brainly.com/question/31821734

#SPJ11

How do you factor this expression: x^3 + 9x^2 + 27x + 27. Thanks! :)

Answers

Answer:

(x + 3)³

Step-by-step explanation:

Use rational root test to check for possible rational roots.

Factors of 27 are 1, 3, 9, and 27.

Factors of 1 are 1.

Possible rational roots are:

±1/1, ±3/1, ±9/1, ±27/1

Checking each one, we find that -3 is a root.  So x + 3 is a factor.

Knowing that, we can use grouping to factor.

x³ + 9x² + 27x + 27

x³ + 9x² + 18x + 9x + 27

x (x² + 9x + 18) + 9 (x + 3)

x (x + 6) (x + 3) + 9 (x + 3)

(x + 3) (x (x + 6) + 9)

(x + 3) (x² + 6x + 9)

(x + 3) (x + 3)²

(x + 3)³

The diagonals of kite KITE intersect at point P. If TKE= x+6 and IEK= 2x, find IKE

Answers

The length of IKE is 2x - 12.

What is equation?

A condition on a variable that is true for just one value of the variable is called an equation.

Since KITE is a kite, we know that KT = IT and KE = IE. Let's call the length of these diagonals d. Then we have:

KT + TI = d

KE + EI = d

Substituting in the given values, we get:

x + 6 + 2x = d

2x + IE = d

Solving for d in the first equation, we get:

3x + 6 = d

Substituting this into the second equation, we get:

2x + IE = 3x + 6

Solving for IE, we get:

IE = x + 6

Therefore, IKE is equal to:

IKE = IT - IE

IKE = (d - KT) - (x + 6)

IKE = (3x + 6 - x - 6) - (x + 6)

IKE = 2x - 12

So, the length of IKE is 2x - 12.

Learn more about equation on:

https://brainly.com/question/27893282

#SPJ4

The diagonals of kite KITE intersect at point P. If TKE= x+6 and IEK= 2x, find IKE

1. Margo can jump 58 times in 1 minute. About how many times can Margo jump in
5 minutes? (Show your work. Write your final answer on the line.)
2. Write the decimal number that the shaded portion of the model represents on the line.

Answers

Answer: 290

Step-by-step explanation:

58 x 5 = 290

Margo jumps 290 times in five minutes

Sophia tas $146.32 imfer savings account. She has -3212.19 in her checking account
Which one of the following inequalities correctly compares the account values
Choose 1 answer
146.22 < -212.19
-212.13 < 146.22
Which one of the following descriptions is comed
Choose 1 answer
Sophia's savings account has a lower account value than her checking account

Answers

Answer: 1. -212.13 < 146.22

2. Sofia‘s checking account has a lower account value in her savings account

Step-by-step explanation: Your welcome

Answer:

B

Step-by-step explanation:

:)

A monthly cell phone plan charges $5. 00 for the first 300 text messages used and $0. 15 for each additional message. On this plan, what is the number of text messages that must be used in a month in order to make the average cost per message $0. 05?.

Answers

To achieve an average cost per text message of $0.05 on the monthly cell phone plan, a certain number of additional text messages beyond the first 300 need to be used.

The monthly cell phone plan charges a fixed amount of $5.00 for the first 300 text messages and an additional $0.15 for each extra message. To find the number of text messages needed to achieve an average cost of $0.05 per message, we can set up an equation.

Let's denote the total number of text messages used as "x" (including the first 300 messages). The cost for the first 300 messages is $5.00, and the cost for the additional messages is (x - 300) * $0.15. The total cost is the sum of these two amounts.

To find the average cost per message, we divide the total cost by the number of messages: (5 + 0.15 * (x - 300)) / x = 0.05. By solving this equation, we can determine the value of x, which represents the number of text messages needed to achieve an average cost per message of $0.05.

Learn more about average cost: brainly.com/question/29509552

#SPJ11

To achieve an average cost per text message of $0.05 on the monthly cell phone plan, a certain number of additional text messages beyond the first 300 need to be used.

The monthly cell phone plan charges a fixed amount of $5.00 for the first 300 text messages and an additional $0.15 for each extra message. To find the number of text messages needed to achieve an average cost of $0.05 per message, we can set up an equation.

Let's denote the total number of text messages used as "x" (including the first 300 messages). The cost for the first 300 messages is $5.00, and the cost for the additional messages is (x - 300) * $0.15. The total cost is the sum of these two amounts.

To find the average cost per message, we divide the total cost by the number of messages: (5 + 0.15 * (x - 300)) / x = 0.05. By solving this equation, we can determine the value of x, which represents the number of text messages needed to achieve an average cost per message of $0.05.

Learn more about average cost: brainly.com/question/29509552

#SPJ11

How many seconds are in 5 years?

Answers

there are 157680000 seconds in 5 years!

1.
Lines, and I are parallel and I, is a transversal.
.
3
4
h
Which statement is true?
A. mZ1 = 90°
B. mZ1 = m24
C. m22 + m 24 = 180°
D. m22 + m 23 = 180°

1.Lines, and I are parallel and I, is a transversal..34hWhich statement is true?A. mZ1 = 90B. mZ1 = m24C.

Answers

Answer:

B

Step-by-step explanation:

∠1 = ∠ 4  

corresponding angles are congruent

PQR ~MNO. What is the length of side QR?

PQR ~MNO. What is the length of side QR?

Answers

The length of the QR is 16 cm when PQR ~MNO

In the given question, it is given that two similar triangles as PQR ~MNO

Then, the corresponding sides will be in equal proportion to each other as follows

PQ / MN = PR / MO = QR / NO

We need to find the length of the side QR

As above relations are given,

\(\frac{PQ}{MN}\) = \(\frac{PR}{MO}\) = \(\frac{QR}{NO}\)

\(\frac{30}{10}\) = \(\frac{5x + 7}{x+5}\) = \(\frac{4x}{\frac{16}{3} }\)

Equating all the fractions, equal to each we'll find

\(\frac{5x + 7}{x+5}\) = \(\frac{30}{10}\)

5x + 7 = 3(x +5)

5x + 7 = 3x + 15

2x = 8

x = 4

We know that, the length of the QR = 4x cm = 4 x 4 cm = 16 cm

Therefore, the length of the QR is 16 cm when PQR ~MNO

To learn more about, similar triangles, here

https://brainly.com/question/25882965

#SPJ1

Use the Law of Cosines to solve for the missing angle of the oblique triangle. Round to the nearest tenth.
a = 15, b = 21, c = 28;
find angle A.

Answers

We are given the lengths of three sides of an oblique triangle (a, b, c) and we need to find angle A using the Law of Cosines. The Law of Cosines states that in any triangle, the square of one side is equal to the sum of the squares of the other two sides minus twice the product of their lengths multiplied by the cosine of the included angle.

In this case, we have the lengths of sides a, b, and c, and we want to find angle A. The first paragraph will provide a summary of the answer, while the second paragraph will explain how to apply the Law of Cosines to find angle A.

Using the Law of Cosines, we can write the equation as: c^2 = a^2 + b^2 - 2ab cos(A). Substituting the given values, we have 28^2 = 15^2 + 21^2 - 2 * 15 * 21 * cos(A). Simplifying, we get 784 = 225 + 441 - 630 * cos(A). Rearranging the equation, we have 784 - 225 - 441 = -630 * cos(A). Solving for cos(A), we get cos(A) = -432 / -630 = 0.6857. To find angle A, we take the inverse cosine (cos^-1) of 0.6857 using a calculator or a trigonometric table. The approximate value of angle A is A ≈ 46.9 degrees (rounded to the nearest tenth). Therefore, angle A is approximately 46.9 degrees.

To learn more about oblique triangle: -brainly.com/question/31613540#SPJ11

Solve the following recurrence relation x₀ = 0, xₙ = 1, xₙ = 4xₙ₋₁ - 3nₙ₋₂ Find the general solution. x = 2x - y y =-x + 2 y

Answers

The general solution to the recurrence relation xₙ = 4xₙ₋₁ - 3nₙ₋₂ with initial conditions x₀ = 0 and x₁ = 1 is xₙ = 2ⁿ⁺¹ - n - 1.

The given recurrence relation xₙ = 4xₙ₋₁ - 3xₙ₋₂, with initial conditions x₀ = 0 and x₁ = 1, can be solved by analyzing the recursive formula. By examining the pattern, we observe that each term xₙ is derived by multiplying the previous term xₙ₋₁ by 4 and subtracting 3 times the term xₙ₋₂.

By solving for xₙ in terms of n using the initial conditions, we find that the general solution is xₙ = 2ⁿ⁺¹ - n - 1.

This solution combines a geometric pattern (2ⁿ⁺¹) with a linear decrement (n + 1) and an offset (-1). It satisfies the initial conditions and represents the sequence for any value of n.

Learn more about Multiplying click here :brainly.com/question/25834626

#SPJ11

What is another name for XW?
Name a ray with an endpoint X.
Give another name for WX.
What’s another name for AXW?
Double points

What is another name for XW?Name a ray with an endpoint X.Give another name for WX.Whats another name

Answers

Another name for AXW is <X

What is another name for XW?

The arrow on XW implies that the segment XW is a ray, such that any of the points X or W can be the starting point

Hence, another name for XW is WX

Name a ray with an endpoint X.

A ray with an endpoint X is a ray that ends at point X

An example of such ray is XY

Give another name for WX.

The arrow on WX implies that the segment WX is a ray, such that any of the points X or W can be the starting point

Hence, another name for WX is XW

What’s another name for AXW?

The name AXW represents an angle

An angle can be named after its middle point

Hence, another name for AXW is <X

Read more about rays, points and lines at:

https://brainly.com/question/14366932

#SPJ1

Simplify the expression 11+3(−5+4)

Answers

Answer:

= 11+3(-1)

= -14

The answer is -14.

Step-by-step explanation:

Please mark me brainliest

What is the value of x? 30 points to whoever answers QUICK!!

What is the value of x? 30 points to whoever answers QUICK!!

Answers

Answer:

i think the anwser is eight

There are 500 sheets in a pack of paper. 500 sheets of paper weigh 2.5kg.
Work out the weight of 50 sheets of paper.

Answers

Answer:

It's a proportion:

500=2.5

50=x

2.5×50:500=0.25kg

50 sheets weigh 0.25 kg

Step-by-step explanation:

Answer:

0.25

Step-by-step explanation:

the weight of a sheet = 2.5kg/500

the weight of a sheet = 0.005kg

the weight of 50 sheets = 0.005 * 50

the weight of 50 sheets = 0.25kg

OR

since it's a uniform rate

500 sheets = 2.5kg

50 sheets = xkg

then you cross multiply.Having:

500*x = 2.5 * 50

500x = 125

then x = 125/500

x = 0.25

Data was collected for a city that indicates that crime increases as median income decreases. The relationship was moderately strong. What would be an appropriate value for the correlation

Answers

In the given case, where data was collected for a city that indicates that crime increases as median income decreases, and the relationship was moderately strong, an appropriate value for the correlation is the Pearson correlation coefficient. Pearson's correlation coefficient is a measure of the strength of a linear relationship between two variables.

It is a statistical measure that quantifies the degree of association between two variables, in this case, crime and median income. The Pearson correlation coefficient is a number between -1 and 1, where -1 indicates a perfectly negative correlation, 0 indicates no correlation, and 1 indicates a perfectly positive correlation. In the given case, as the relationship was moderately strong, the appropriate value for the correlation would be close to -1.

To find the Pearson correlation coefficient between crime and median income, we use the following formula:

r = (NΣxy - (Σx)(Σy)) / sqrt((NΣx² - (Σx)²)(NΣy² - (Σy)²))

Where,r = Pearson correlation coefficient, N = Number of pairs of scores, x = Scores on the independent variable (Median Income), y = Scores on the dependent variable (Crime), Σ = Sum of the values in parentheses

The correlation coefficient will be between -1 and 1. The closer the value is to -1 or 1, the stronger the correlation. The closer the value is to 0, the weaker the correlation.

Know more about Pearson's correlation coefficient  here:

https://brainly.com/question/4117612

#SPJ11

Can anyone help me pls????????

Can anyone help me pls????????

Answers

Answer its quite easy i hope this will be right

1) 4.1833

2) 5.29+2.366=7.656

RESPOND QUICK PLEASE FOR 50 POINTS

Question
A triangle has two sides of length 5.6 ft and 7.8 ft.

Which value could be the length of the third side of the triangle?

Responses

1.7 ft
1.7 ft

2.2 ft
2.2 ft

4.8 ft
4.8 ft

13.9 ft

Answers

Answer:2.2 ft

Step-by-step explanation:

because

if line b is perpendicular to line a, and line c is perpendicular to line a, what is the slope of line c?

Answers

Answer:

what do the lines look like

Step-by-step explanation:

Define the term functions limits and continuity as used in
business calculus and use an example

Answers

In business calculus, the term "functions" refers to mathematical relationships that associate inputs (typically denoted as x) with corresponding outputs (typically denoted as y). Functions can represent various aspects of business operations, such as revenue, cost, profit, demand, and supply.

The concept of "limits" in calculus deals with the behavior of a function as the input approaches a particular value. It determines the value that the function approaches or tends to as the input gets arbitrarily close to a specified value. Limits are essential for analyzing the behavior of functions near certain points, understanding rates of change, and evaluating derivatives and integrals.

"Continuity" of a function refers to its smooth and unbroken nature, without any abrupt jumps, holes, or vertical asymptotes. A function is continuous if its graph can be drawn without lifting the pen from the paper. Continuity ensures that small changes in the input correspond to small changes in the output, which is crucial for reliable analysis and prediction.

For example, consider the function f(x) = 2x + 1. This linear function represents a business scenario where x represents the number of units sold, and f(x) represents the total revenue generated. The limit of f(x) as x approaches 2 is 5, indicating that as the number of units sold approaches 2, the total revenue approaches $5. Since f(x) = 2x + 1 is a linear function, it is continuous across its entire domain.

Learn more about functions, limits, and continuity in calculus here:

brainly.com/question/29297331

#SPJ11

10. Square is a
a. Rectangle
b. Rhombus
c. Both
d. None of these​

Answers

Answer:

d. None of these​

Hope it helps

Have a great day : )

Answer:

Square is a rhombus. (option b)

Which number has a prime factorization of 2x2x5x5x7x7

Answers

Answer:

4900

Step-by-step explanation:

multiply all those numbers together

2x2x5x5x7x7 = 4900

Find the midpoint of the line segment with the endpoints A and B.
A(10,6); B(8,4)

Answers

Answer:

(9,5)

Step-by-step explanation:

10+8/2=18/2=9

6+4/2=10/2=5

What is the solution to –2|2.2x – 3.3| = –6.6?
x = –3
x = 3
x = –3 or x = 0
x = 0 or x = 3

Answers

Answer:

D

Step-by-step explanation:

A ball is thrown from an initial height of 2 feet with an initial upward velocity of 44 ft./s the balls height in feet after two seconds is given by the following find all values of tea for which the balls high is 22 feet

Answers

To determine the values of t (time) for which the ball's height is 22 feet, we need to use the equation that describes the height of the ball as a function of time.

The equation for the height of a ball in free fall can be expressed as:
h(t) = -16t^2 + v0t + h0

Where:
h(t) is the height of the ball at time t,
v0 is the initial upward velocity of the ball,
h0 is the initial height of the ball.

Given the values:
v0 = 44 ft/s (initial upward velocity)
h0 = 2 ft (initial height)
We want to find the values of t when h(t) = 22 ft.

Plugging in the values into the equation:
22 = -16t^2 + 44t + 2

Now, let's rearrange the equation to solve for t:
16t^2 - 44t + 20 = 0

To solve this quadratic equation, we can factor it:
4(4t^2 - 11t + 5) = 0

Now, solve the quadratic equation:
4t^2 - 11t + 5 = 0

Factoring further:
(4t - 5)(t - 1) = 0

Setting each factor equal to zero:
4t - 5 = 0 or t - 1 = 0

Solving for t in each case:
4t = 5 or t = 1

Dividing by 4:
t = 5/4

Therefore, the two values of t for which the ball's height is 22 feet are t = 5/4 seconds and t = 1 second.

The circumference of a circle is 8π cm. What is the DIAMETER of the circle?

Answers

Answer:

8cm

Step-by-step explanation:

The circumference of a circle= π×diameter(d)

= πd= 8π cm

d=8π/π =8cm

Help meeeee 0
Plssssss

Answers

Answer:

Whats the question

Step-by-step explanation:

Jack is a farmer and he wants to know the mean weight of all the potatoes in a sack.
He randomly selects 10 potatoes and weighs them. Their weights, to the nearest ounce are 5, 8, 9, 11, 7, 7, 8, 9, 12, and 7.
What is the best estimate of the mean weight of all the potatoes in the sack?

Answers

Answer:

8.3 is the mean weight of the sack.

Step-by-step explanation:

5+8+9+11+7+7+8+9+12+7=83

83/10=8.3

8.3 is the mean weight of the sack.

For more confirmation: https://brainly.com/question/1917540

I don’t know how to use parallel lines to prove things...

I dont know how to use parallel lines to prove things...

Answers

Answer:

omg wow

Step-by-step explanation:

Other Questions
Emeline has a shoe box measuring 11 x6x8. Noah has one measuring 12 x 5 x 7. What is the difference is surface areabetween their boxes? a swimming pool has the shape of a right circular cylinder with radius 20 feet and height 10 feet. suppose that the pool is full of water weighing 62.5 pounds per cubic foot. a charge 48.0 cm -long solenoid 1.35 cm in diameter is to produce a field of 0.500 mt at its center. How much current should the solenoid carry if it has 995 turns of the wire? 1.The difference between a number and 7 is greater than -16.2.Twice a number is less than 303.5 more than a number is greater than or equal to 274.the equotient a number and -6 is at -85.14 subtract from a number is no less than 506.42 is fewer than the product of a number and -3 7.two-fifths of a number has a maximum value of 75 8. 20 less than a number is least 100 6 + 9 = 33Need to solve How does Neptune torment Ulysses? profits increase during the __________ stage of the product life cycle. a. introduction b. growth c. decline d. product development e. maturity 20 points + Brainliest. Help please!In an adiabatic process, the pressure on an ideal gas is increased to 14 times its initial value. The initial volume is 78 L. What is the final volume? Let = 1.67.A. 16 LB. 22 LC. 8.1 LD. 10 L Wanda bought 4 plastic discs. Each disc weighs 0.7 ounces. How much do the 4 plastic discs weigh in all? Joe Techno placed an order to an online technology products company. The bundling of a printer, desk-top computer and 2 GB external hard drive in a single shipment by the wholesaler constitutes which of the following 21st0-century channel roles?A. system solverB. Resource prospector malacca, thang-long, ayutthaya, aceh, bantam, mataram: these southeast asia cities: Please see image attached. I was told by the instructor the answer is B but I dont understand why? each daugher cell inherits a daughter strand and original template strand from parent, so shouldnt the answer be A? Why do the strands split up to each daughter cell?Although DNA polymerases replicate DNA with extremely high fidelity, these enzymes do make mistakes at a rate of about 1 per every 100,000 nucleotides. Given that each human cell contains 23 pairs of DNA molecules with a collective 3 billion base pairs, it would amount to about 60,000 mistakes every time a cell replicates its DNA! Fortunately, there are extremely sophisticated mechanisms that fix most, but not all, of those mistakes. Suppose a cell (let's call it cell X ) in the regenerating liver of a patient is replicating its DNA molecules for mitosis, and suppose an " A " to " C " mismatch (see the sequences below) is present in one of the newly synthesized chromosome DNA because somehow this mismatch has escaped detection by repair mechanisms. Original template strand: 5'GGTTCAGTACGATTGCAAGGCCTTAAGGT3Newly synthesized strand: 3'-CCAAGTCATGCTAACGCTCCGGAATTCCAA- 5Which one of the following statements is most likely correct? A. After mitosis of the cell X, both daughter cells possess a permanent mutation. B. After mitosis of the cell X, one daughter cell possesses a permanent mutation. C. After mitosis of the cell X, one daughter cell will possess the AC mismatch, which will give rise to a permanent single base mutation after the DNA is replicated once. D. After mitosis of the cell X, both daughter cells possess the AC mismatch, which will give rise to a permanent single base mutation to be inherited by all of their daughter cells. the uniform commercial code has been adopted by: group of answer choices most, but not all, states. at least in part by all states. fewer than half of the states. in its entirety by all states. Calculate the Area & Perimeter9m16m10m Why did Harry Truman represent the United States at the Potsdam Conference? He had been elected president in 1944, defeating Franklin Roosevelt. He had become president after the death of Franklin Roosevelt. He attended on behalf of the United States because Franklin Roosevelt was ill. He had better relations with the other Allies than Franklin Roosevelt. Media Effects and GenderRespond to the following prompts by providing examples of each:A) Mass Communication sets or perpetuates some gender agendas. Provide links to examples if you wish!B) Mass Communication influences attitudes and opinions. 32 ft/h = ___ yd/day Quick questionnnnn :P answer quickly please:) Round your answer to the nearest tenth.You are planting a circular garden in your backyard. The diameter of the garden is 12ft. If you only wanted to plant roses around % of the perimeter, how many feet ofroses should you plant?