Look at the image and choose the option with the correct dish and country that match the image.


Ceviche from Panama
Cachapas from Venezuela
Bandeja paisa from Columbia
Tortilla from Spain

Look At The Image And Choose The Option With The Correct Dish And Country That Match The Image. Ceviche

Answers

Answer 1

Answer:

Bandeja Paisa from Columbia is the answer.

Answer 2

Answer:

Bandeja Paisa from Columbia is the answer.

Explanation:


Related Questions

will give branliest pls help

will give branliest pls help

Answers

pretty sure it’s true
Hello!

\(\boxed{\boxed{\bf THEME:\: COMPLETAR\:\:LA\:\:ORACI\acute{O}N}}\)

Answer:

De niño, mi tío era muy bajo.

Pretérito imperfecto:

Yo → era

tú → eras

el, ella ud. → era

nosotros → éramos

vosotros → erais

ellos, ellas, uds → eran

vos → eras

--------------------------------------------------------------------------------------------------------------

\(\heartsuit\) Greetings \(\heartsuit\)

Sincerely: anapaulacbellido

HELPP
List the definite and indefinite articles and their meanings: Hint: there are 8

Answers

Answer:

Definite Articles:

El - Meaning "the" for masculine singular nouns.

La - Meaning "the" for feminine singular nouns.

Los - Meaning "the" for masculine plural nouns.

Las - Meaning "the" for feminine plural nouns.

Indefinite Articles:

5. Un - Meaning "a" or "an" for masculine singular nouns.

Una - Meaning "a" or "an" for feminine singular nouns.

Unos - Meaning "some" or "a few" for masculine plural nouns.

Unas - Meaning "some" or "a few" for feminine plural nouns.

Explanation:

These articles are used to indicate the gender and number of nouns in Spanish sentences. The definite articles specify a particular noun, while the indefinite articles are used to refer to non-specific or unidentified nouns.

FIll in the blank
A ellas _________ las pantorrillas y los pies porque corrieron mucho.

FIll in the blankA ellas _________ las pantorrillas y los pies porque corrieron mucho.

Answers

Answer:

A ellas les duelen las pantorrillas y los pies porque corrieron mucho. (Translation: Their calves and feet hurt because they ran a lot.)

A ellas les duelen las pantorrillas y los pies porque corrieron mucho.

Sara es mi _______________.

Answers

Answer:

yam

Explanation:

Sara es mi yam. yam means name

Answer:

hermana

Explanation:

eres alta_____ jugar al basquetbol?

Answers

I would need more info to answer your question, but here are is a possible answer:

- eres alta (por) jugar al basquetbol?

Translation: are you tall (for) playing basketaball?
Para
es la respuesta

PLS HELPPPP!!!!
I’ll mark brainliest

PLS HELPPPP!!!!Ill mark brainliest

Answers

all the reflexive pronouns are “me” until you get to 20, that one is “nos”.
11: visto
13: arreglo
24: pongo
26: acuesto
21: cansamos
Me visto
Me arreglo
Me pongo
Me acuesto
Nos cansamos

6. Escribe en la forma negativa.
33. Luis, habla.
34. Jacinta, come más.
35. Carlos, levántate.
36. Teresa, ven.

Answers

La forma negativa, usando cada grupo de palabras, es:

33. Luis no habla.34. Jacinta no come más.35. Carlos, no te levantes.36. Teresa, no vengas.

Oraciones negativas.

Estas oraciones se diferencian de la forma afirmativa ya que les precede la negación absoluta "no" al verbo principal dentro de la oración:

Forma afirmativa: sujeto + verbo conjugado + complemento.Forma negativa: sujeto + no + verbo conjugado + complemento.

Sin embargo, adicionalmente en algunas ocasiones, cuando el verbo en cuestión finaliza con un pronombre reflexivo, dicho pronombre reflexivo suele retirarse del verbo y ubicarse antes de este separado:

Julián, ¡duérmete!Julián, no te duermas.

Si deseas obtener más información sobre el tiempo presente, puedes visitar el siguiente enlace: https://brainly.com/question/14934732

i dont know how to do spanish at all and i got two work sheets i have no idea how to do

Answers

Hello and regards ericrobinsonjr06

INSTRUCTIONS: The sentences are numbered, the first part is completed in the image, in the boxes. [See attached image]

Clara contestó el teléfono.Yo saludé a Rosa.Nosotros hablamos de la fiesta del sábado pasado.Enrique y Carlos invitaron a muchas personas.Sus padres prepararon muchas cosas para comer.Todos pasaron un buen rato allí.Tú cantaste y bailaste mucho.Yo regresé a casa tarde.Megan y Stephanie pintaron mucho en la clase de arte.Nick corrió tres millas en la clase de educación física.Yo leí un cuento sobre Don Quixote.Sam y yo levantamos pesas después de las clases.Jordan y Mike aprendieron mucho en la clase de español.Jaime nos ayudó con la tarea para la clase de inglés.Nosotros comimos mucha comida en la fiesta anoche.

\(\cline{1-2}\)

Translations of sentences from Spanish to English:Clara answered the phone.I greeted Rosa.We talked about last Saturday's party.Enrique and Carlos invited many people.Their parents prepared many things to eat.Everyone had a good time there.You sang and danced a lot.I returned home late.Megan and Stephanie painted a lot in art class.Nick ran three miles in gym class.I read a story about Don Quixote.Sam and I lifted weights after class.Jordan and Mike learned a lot in Spanish class.Jaime helped us with the homework for English class.We ate a lot of food at the party last night.Explanation:

The preterite tense, also known as the past tense, is a verb tense that is used to talk about actions, events or situations that occurred at a time before the present. In Spanish, there are two forms of the preterite: the indefinite preterite or simple perfect preterite and the imperfect or imperfect indicative preterite.

The indefinite past tense is used to talk about specific actions, which took place at a specific moment in the past and have already ended. For example: "Yesterday I bought a book." In this sentence, "I bought" is the past tense verb that indicates an action performed at a specific time in the past.

The imperfect tense, for its part, is used to describe actions that had a duration in the past, but do not have a defined completion. For example: "When I was a kid, he played soccer every day." In this sentence, "jugaba" is the past tense verb that indicates an action that was performed frequently in the past, but does not have a specific time of completion.

In addition, the imperfect tense is also used to describe the context of a situation in the past, such as time, place, or circumstances. For example: "It was a dark and cold night when he got home." In this sentence, "was" is the past tense verb that describes the context of the situation in the past.

\(^_^ )If you want to learn more, I share this link to complement your learning:

https://brainly.com/question/29904849

i dont know how to do spanish at all and i got two work sheets i have no idea how to do

Write the preterite forms for each

Write the preterite forms for each

Answers

Los chicos y tú miran
La profesora escribe en la pizarra
Anunciara Maria las noticias nuevas?
Yo veo a tu mamá en el centro comercial
Las chicas pagan en efectivo
Ana compra una falda verde
Yo buscaré mi tarea
Los estudiantes empieza su tarea
Yo pago por la comida
Tu y yo volvemos demasiado tarde
La familia asistió a la boda anoche
Las chicas ganaron el partido
Yo conozco a tu mamá
Elena y Pablo discutieron la lección
Pedro almuerzo en la cafetería
La profesora explicará la tarea
Yo practicaré el vocabulario

Answer:

HEEEEEEEEEEEEEEEEEEEY MACARANA

Explanation:

Please answer as soon as possible. Thanks :)

3.Mira el dibujo C: Esta chica participa en una competencia. Describe una competencia en que participaste o que miraste.

Please answer as soon as possible. Thanks :)3.Mira el dibujo C: Esta chica participa en una competencia.

Answers

Answer:

esta copitiendo en natacion

hago una grafica en la que muestres como los medio digitales promueven la creacion de comunidades virtuales y clasificala de las basicas a las mas complejas¿que medios crees que promuven el surjimiento de estas ultimas?

Answers

As we move from fundamental to more complex virtual communities, the computerized media stages tend to offer more Advanced highlights, interactivity, and immersive encounters.

What is the use of digital media about?

Advanced  virtual communities regularly include shared interface or objectives, whereas complex virtual communities may include virtual universes where clients can connected in intelligently and energetic situations.

It is vital or critical to note that virtual communities can advance and alter quickly as innovation propels and modern computerized media stages develop. The classification given over is fair a common system, and the real categorization may change depending on different variables such as innovative headways, client behaviors, etc.

Learn more about digital media from

https://brainly.com/question/30776215

#SPJ1

HELP HELP will give BRAINLYST Write a sentence expressing how much body parts you have

 HELP HELP will give BRAINLYST Write a sentence expressing how much body parts you have

Answers

Yo tengo dos muñecas.
Yo tengo una nariz.
Yo tengo dos orejas.
Yo tengo una boca.
Yo tengo dos rodillas.
Yo tengo una garganta.
Yo tengo dos piernas.
Yo tengo dos manos.
Yo tengo una estomago.
Yo tengo una esperada.

Bibliotecas y parques


In this activity, you will review the information in Spanish on libraries and parks in Chile, and write five to eight sentences in Spanish for your school’s newspaper about free cultural activities offered in the libraries and parks of Santiago. Submit the response to the teacher

Answers

En Santiago, las bibliotecas y los parques ofrecen una gran variedad de actividades culturales gratuitas. En las bibliotecas, se pueden encontrar clubes de lectura, talleres de escritura creativa, presentaciones de libros y charlas con autores. Además, muchas bibliotecas tienen salas de estudio y acceso a internet gratuito. En los parques, hay eventos de música en vivo, teatro al aire libre y presentaciones de danza. También se pueden encontrar clases de yoga y actividades recreativas para niños. Las actividades culturales en las bibliotecas y los parques son una excelente manera de aprender y disfrutar de la cultura chilena de forma gratuita. ¡No dudes en visitarlos!

How would you write the following date? June 5th
els 5 del julio
el 5 de junio
el 5 da junio
en 5 da julio

Answers

Answer:

el 5 de Junio

Explanation:

what happens when you slowly pulled the paper?​

Answers

? I mean friction and such happen you need to elaborate
Que pasa cuando jalas el papel despacio?


If you have been keeping up with the goals you set for yourself in the "Becoming a Lifelong Learner Part 1” assignment, you are well on your way to becoming a lifelong Spanish learner. As you know by now, having regular habits of conversing with Spanish speakers, getting information from Spanish sources, and participating in Spanish cultural events can set you up for unique opportunities throughout your life. Take a few moments to reflect on your experience developing these habits and how you imagine your connection to Spanish unfolding over the next several years. Write two paragraphs in English based on the directions below: In the first paragraph, write about your experience developing these habits and how you project you will stay connected to Spanish and its culture in the future. In a second paragraph, reflect on how knowing Spanish will help you in your life academically, personally, socially, and even professionally. Give specific examples and details.

Answers

You can use the two paragraphs below as examples for your personal writing on being a lifelong learner of Spanish and how it will benefit you.

As a lifelong learner of Spanish, I have truly enjoyed the process of developing habits that allow me to immerse myself in the language and culture. Through online language exchange platforms and local Spanish conversation groups, I have been able to engage in meaningful conversations, exchange ideas, and form connections with people from various Spanish-speaking countries. Additionally, I have made it a habit to consume information from Spanish sources, such as news articles, podcasts, and books. I plan to continue participating in Spanish cultural events, such as festivals, concerts, and exhibitions, to further immerse myself in the vibrant and diverse traditions of Spanish-speaking countries. I also intend to explore opportunities for travel and study abroad, allowing me to experience firsthand the richness of Spanish-speaking countries and practice my language skills in authentic contexts.

Knowing Spanish will have numerous benefits in my life academically, personally, socially, and professionally. Academically, Spanish will open up a world of opportunities for me to pursue advanced studies in fields such as linguistics, literature, or international relations, where proficiency in Spanish is highly valued. Personally, my knowledge of Spanish allows me to appreciate Spanish literature, music, and art in their original forms, deepening my cultural understanding and enriching my personal experiences. Socially, speaking Spanish allows me to connect with a wider range of people, both locally and internationally, fostering cross-cultural friendships and broadening my social horizons. Professionally, being fluent in Spanish opens up a plethora of career opportunities. With the increasing globalization, many companies are seeking individuals who can communicate effectively in multiple languages.

Why studying Spanish is important

Being a lifelong learner of Spanish is important because it opens doors to new opportunities, expands cultural understanding, and enhances personal growth. Spanish is one of the most widely spoken languages in the world, allowing learners to communicate with millions of people and access diverse perspectives.

Learning Spanish promotes cross-cultural connections, fostering empathy and appreciation for different cultures. It also boosts cognitive abilities and memory, improving overall brain health. Moreover, being proficient in Spanish enhances employability, as it is increasingly sought after in various industries. Embracing lifelong learning of Spanish enables continuous growth, enriches experiences, and empowers individuals to navigate an interconnected global society.

Learn more about Spanish here:

https://brainly.com/question/18552923

#SPJ1

Ummm anybody want to do this for me? (lol)-------Brainliest will be rewarded as well as 50 points.

Ummm anybody want to do this for me? (lol)-------Brainliest will be rewarded as well as 50 points.
Ummm anybody want to do this for me? (lol)-------Brainliest will be rewarded as well as 50 points.

Answers

Answer:

1. cerró

2.alquilé

3.caminaron

4.regalaron

5.contaste

6.lavamos

7.cepillé

8.manejaron

Explanation:

Hope this helps, let me know if i'm wrong

Answer:

cerrar

aquilo

Explanation:

guys please help with spanish class
Read the paragraph and select
the option that has the vocabulary needed to complete the sentences.

guys please help with spanish classRead the paragraph and selectthe option that has the vocabulary needed

Answers

Answer B.

Spanish is my first language

Pls help this was due like two days ago In this activity, you will record a radio advertisement, in Spanish, for your favorite restaurant or any local eatery that you've been to. Use any audio recording software. Submit that audio file to your teacher. In your recording, use comparatives, superlatives, and adjectives to describe the food.

Answers

Answer:

Mi restaurante favorito es El Sarape. Me gusta comer fajitas allí. El plato es ligeramente picante y tiene un arco iris de verduras. Por ejemplo, hay pimientos rojos, espinacas verdes oscuras y cebollas blancas. El servicio es muy agradable y paciente. Todos los empleados pueden hablar inglés y español, así que la comunicación es fácil para sus clientes mexicanos y americanos. La calidad de la experiencia es como ningún otro restaurante en el que he estado, pero esa es mi preferencia.

Explanation:

My favorite restaurant is El Sarape. I like to eat fajitas there. The dish is slightly spicy and has a rainbow of vegetables. For example, there are red peppers, dark green spinach, and white onions. The service is very nice and patient. All of the employees can speak English and Spanish, so communication is easy for their Mexican and American customers. The quality of experience is like no other restaurant I've been to, but that is my preference.

I would send a file, but I assume it's supposed to be in your voice. So instead I wrote you a Spanish script that you could use.

Answer:

Yo acostumbro ir al restaurante "Sabor a mi" porque no solo su comida es de excelencia sino que también el ambiente es muy familiar y la música es en vivo en la cual el músico interactúa sanamente con los comensales. Este restaurante sirve comida típica mexicana, lo cual es su especialidad, pero también sirve comida internacional. Son dos sus especialidades, el pozole y las enchiladas, estos dos productos los han elevado a un nivel excelso, ¡están riquísimos! los invito a que los prueben y seguramente quedaran encantados. Ya que la mayoría de sus platillos son mexicanos se trata de comida en la que uno de los ingredientes es el chile pero este lo ponen al gusto del cliente.

Existen otros restaurantes que tienen el mismo concepto y su comida también es rica pero la diferencia radica en el servicio ya que aquí siempre te atienden con una sonrisa y te hacen sentir que eres una persona muy importante; la otra diferencia es el precio ya que aquí los precios son económicos y dan precios especiales para familias.

Este restaurante se encuentra inscrito en un programa de ayuda a los más necesitados de tal manera que parte de sus utilidades las destinan para dar de comer a personas necesitadísimas y de muy bajos recursos.

En resumen en "Sabor a mi" la comida es riquísima, existe un excelente ambiente familiar y sus precios accesibles son incomparables.

ay una person me puede ayudad por favor

Answers

Answer:

yaa say ..............

Answer:

What do you need help with?

Explanation:

Also it depends on the subject xD

you will write a short paragraph, in Spanish, comparing a social club to a sports club. For instance, you could compare an environmental protection club with a tennis club. Include information about the activities and benefits for members. Submit the response to the teacher.​

Answers

Answer:

Explanation:

la diferenia de social club y sports club , es que el social club es un actividad de adentro, es aveses con el comunidad, tambien te pueden poner en un  voluntario y bueno. El sports club es un actividad por fuera que es solo un equipo y solo fuegan fuegos afuera, un deporte, fuegan con muchos mas equipos.

Answer:

La diferencia entre un club social y un club deportivo es que un club social es una actividad interna mientras se habla y socializa, mientras que un club deportivo es un grupo más activo y generalmente está afuera. Como si hubiera un club de fútbol afuera y un club de teatro en un teatro.

Explanation:

PPF shows various combinations of ………………goods that can be produced by using the available resources.​

Answers

Answer:

Some

Explanation:

PPF shows various combinations of ……some…………goods that can be produced by using the available resources.​

The land body located directly across the Strait of Gibraltar from southernmost Spain is _____________.
a) the Iberian Peninsula
b) Northern Africa
c) Italy's 'boot'
d) the Balkan Peninsula
e) Scandinavia

Answers

Should be Northern Africa

What you have learned about spanish foods from various latin countries. use your knowledge to help the students in that class understand how learning a new language can help them in their future careers as chefs.

Answers

Learning a new language, such as Spanish, can be incredibly beneficial for students pursuing a career in the culinary arts, as explained further below.

How are language and culinary arts connected?

Spanish cuisine is rich and diverse, with each Latin American country offering its own unique flavors, ingredients, and culinary traditions. By learning Spanish, aspiring chefs gain access to a whole new world of culinary knowledge and opportunities.

Firstly, communication is key in any kitchen. Being able to effectively communicate with coworkers, staff, and even customers who may speak Spanish opens up doors for collaboration, teamwork, and a more inclusive work environment. It allows chefs to better understand the preferences, cultural influences, and culinary traditions of Spanish-speaking communities, which can greatly enhance their ability to create authentic and culturally diverse dishes.

Additionally, learning Spanish can facilitate connections and networking within the industry. With the growing popularity of Latin American cuisine globally, there is a demand for chefs who can create dishes that are true to their roots. By speaking Spanish, chefs can forge relationships with suppliers, local farmers, and artisans who provide authentic ingredients, ensuring the quality and integrity of their culinary creations.

In conclusion, learning Spanish can greatly benefit future chefs by enabling effective communication, fostering cultural understanding, inspiring creativity, and expanding professional opportunities. Embracing a new language like Spanish enhances one's culinary skills and provides a competitive edge in the dynamic and diverse world of gastronomy.

Learn more about Spanish here:

https://brainly.com/question/18552923

#SPJ1

(30 points!!!!) please At least 2 sentences

21. What can visitors see and do at la Caleta National Marine Park?
Write your answer in English.

Answers

In the caleta national marine park, visitors can see vibrant reefs and shipwrecks. They can also have the opportunity to enfangue and promote five tourism as a significant substitute for fishing in that area.

Aranés is spoken in what part of Spain?
-The town of Val d'Aran
-The Basque region
-Cataluña
-The Galicia region​

Answers

A) the town of Val d’Aran
hope this helps x
The answer is The town of Val d’Aran

PROYECTO: UN VIAJE INOLVIDABLE
What To Include:
READ ALL INFORMATION THOROUGHLY!

Descriptions of the weather:
Write one general sentence stating that the weather is good, bad, beautiful, etc.
Write two specific types of weather, such as sunny, cloudy, cold, hot, mild, raining, snowing, foggy, drizzling, etc. Write the temperature.
Description of the place:
Using the Spanish you've studied so far, describe the appearance of the location by using the correct form of ser with descriptive adjectives. Use hay, meaning "there is" or "there are" to talk about things that are found there. This description should include at least three pieces of information about the location.
Account of the day's events:
Choose three activities per picture. All activities should be in the present tense, since the past tense hasn't been studied in detail. However, with teacher permission, the past tense charts in lesson 1 may be used to tell about specific activities that were done that day.

Use of Spanish in the writing:
Make sure that the verb endings match their subjects.
Check that all irregular verbs are spelled correctly.
Verify that the overall communication is clear and knowledge acquired from the program was clearly applied in your writing.
Make sure that a variety of weather vocabulary is used and there isn't much repetition of the same weather conditions from one picture to the next.
Pictures to include: Include a picture of each of the three locations you reference in your project. These pictures should represent the weather and places you describe in Spanish.

Te toca a ti. This project may be completed as a journal on paper, but can also be a slide show, or any other creative presentation you can think of. It's best to follow the simple steps below to work through it.

Part 1:
Your pictures are the main focus, so begin your project by choosing three pictures that show interesting things, and a variety of weather conditions. For instance, you can use pictures of a ski resort when it's snowing, an adventure park when its raining and the lines for the rides are very short, and a park or beach when the weather is sunny.
Decide how you'd like to put your information together. Choose whether you'll create a journal, a slide show presentation, or some other way to bring your information together.
Make notes on the weather, descriptions, and activities you plan to discuss in the project.
Write your paragraphs in Spanish and have your teacher or a peer edit your work and give you suggestions for improvement if necessary.
Create a rough draft of your journal with writing and pictures all in place.
Edit your work, and make sure verbs are conjugated correctly, adjectives agree with the nouns they modify, and weather expressions are used correctly.
Ask somebody who understands Spanish to edit your work again. Make any changes necessary and then check your work thoroughly for both content and appearance.
If your teacher requires you to present the project, tell your classmates all about your vacation and have fun!



PLEASE TAKE THIS SERIOUSLY I NEED LEGIT, ACCURATE, AND ORIGINAL ANSWERS THANK YOU :)

Answers

According to the images, it can be inferred that the climate in these places would be: En la estación de ski el clima es muy frío, en la playa el clima es muy caliente y en la ciudad el clima es frío y húmedo.

How to describe the images with sentences in Spanish?

To describe the images with sentences in Spanish we must carry out the following procedure:

We must observe the images carefully and identify the different characteristics of the places.Once we have a clear idea about the characteristics of the places, we must create sentences with correct descriptions about the places.

According to the above, some sentences that describe the places are:

En la primera imagen hay una estación de ski en las montañas. Hay nieve que cubre las montañas y muchas personas disfrutando de este lugar. También hay unos cables con asientos para que las personas puedan ascender fácilmente hasta la cumbre y deslizarse por la colina con sus ski.En la segunda imagen hay una playa en la que hay muchas personas. El clima es soleado y el agua azul. Hay varias sombrillas de varios colores para que las personas se protejan del sol.En la tercera imagen hay un auto y varias personas con sombrillas debido a que el clima es frío. Hay charco de agua en la calle y todos tienen frío.

Learn more about weathers in: https://brainly.com/question/14426457

#SPJ1

PROYECTO: UN VIAJE INOLVIDABLEWhat To Include:READ ALL INFORMATION THOROUGHLY!Descriptions of the weather:Write

Write the appropriate indefinite article for the following
1._____chico
2._____mujeres
3._____galleta
4._____amigas
5._____refresco
6._____hombres

Answers

Answer:

1.mi chico

2. idio  tas mujeres

3.rica galleta

4. mi mejores amigas

5.que feo refresco

6.estupi  dos hombres

Explanation:

denada :)

un chico
unas mujeres
una galleta
unas amigas
un refresco
unos hombres

Lee y escoge la mejor respuesta. Read and select the best answer. Estuvimos siete días en la capital chilena y nos dedicamos a recorrerla a pie. Yo no tenía una idea previa de la ciudad; nunca había escuchado demasiado acerca de ella (además es muy difícil imaginar una ciudad que no se conoce). Cada vez que decía que iba a viajar a Chile, los elogios se los llevaba Valparaíso, y Santiago era mencionada más al pasar. Por las calles de Santiago Blog post by: Aniko Villalba Según la lectura, ¿cómo paseaba por la ciudad? (1 point) Metro Taxi Caminando Escuchando

Answers

Answer:

caminando

Explanation:

a pie significa caminar

please help, i dont get it

please help, i dont get it

Answers

1) estoy estudiando español 2) a bailar 3) a cantar 4) yo bailo 5) yo canto 6) canta 7) ella toca 8) a tocar 9) yo trabajo 10)cerca 11) detrás
Other Questions
I. Given a=3, d=3 an= 10 Find the average rate of change on the interval - 1 * 4for the equation y=*? + 4x+1. What sensation does Farquhar experience with terrible suddenness which details suggest that Farquhar's escape occurs in his mind? (1 point) suppose s={r,u,d} is a set of linearly independent vectors. if x=5r 2u 5d, determine whether t={r,u,x} is a linearly independent set. 100 point if anyone can finish all of my work i would really appreciate it From the perspective of computers and networks, _________ is confidence that other users will act in accordance with your organizations security rules.network security trust reliability non-repudiation can you please compare the DNA sequences in thisimage, mark any insertion, deletion, polymorphism, and addition.Discuss about the yellow region in sequences and the nucleotides.discuss all the simi>M12-LCMT-F_D02.ab1TATTCTCTGTTCTTTCATGGGGAAG>M13-LCMT-F_E02.ab1TATTCTCTGTTCTTTCATGGGGAAG >M14-LCMT-F_F02.ab1TATTCTCTGTTCTTTCATGGGGAAG 25 >M15-LCMT-F_G02.ab1TATTCTCTGTTCTTTCATGGGGAAG >M16-LCMT-F_H02.ab1TATTCTCTGTTCTTTCATGGGGAAG>M12-LCMT-F_D02.ab1CAGATTTGGGTACCACCCAAGTATT >M13-LCMT-F_E02.ab1CAGATTTGGGTACCACCCAAGTATT>M14-LCMT-F_F02.ab1CAGATTTGGGTACCACCCAAGTATT 50 >M15-LCMT-F_G02.ab1CAGATTTGGGTACCACCCAAGTATT>M16-LCMT-F_H02.ab1CAGATTTGGGTACCACCCAAGTATT >M12-LCMT-F_D02.ab1GACTCACCCATCAACAACCGCTATG>M13-LOMT-F_E02.ab1GACT CACCCATCAACAACCGCTATG>M14-LCMT-F_F02.ab1GACTCACCCATCAACAACCGCTATG 75 >M15-LCMT-F_G02.ab1GACTCACCCATCAACAACCGCTATG >M16-LCMT-F_H02.ab1GACTCACCCATCAACAACCGCTATG - >M12-LCMT-F_D02.ab1TATTTCGTACATTACTGCCAGTCAC >M13-LCMT-F_E02.ab1TATTTCGTACATTACTGCCAGCCAC>M14-LCMT-F_F02.ab1TATTTCGTACATTACTGCCAGCCAC100 >M15-LCMT-F_G02.ab1TATTTCGTACATTACTGCCAGCCAC >M16-LCMT-F_H02.ab1TATTTCGTACATTACTGCCAGCCAC P How many ways are there to choose five doughnuts if there are eight varieties (and only the type of each doughnut matters)? CHEMISTRY 50 POINTSS!!The electron configuration of an element is shown below.1s2 2s2 2p6 3s2 3p6Name the group this element belongs to in the periodic table and explain your answer.Based on the electron configuration, write one chemical property of this element. Explain how to express -1-cos 5 A/2 as sin , where is an expression in terms of A . How did the Industrial Revolution impact the world 4. Who aside from the Spanish Crown helped fund Columbus' voyage? If F(2) = 10 And F'(X) = X^2f(X) For All X, Find F"(2). Show Your Work. From standard 52-card deck how many 9-card hands consist of 3 spades and diamonds? There are possible 9-card hands consisting of 3 spades and diamonds if an identical product can be sold in two different markets, and no restrictions exist on the sale or transportation of product between markets, the product's price should be the same in both markets. this is known as: a) relative purchasing power parity. b) interest rate parity. c) the law of one price. d) equilibrium. group of answer choices a b c d A mechanic pushes a 3.40 10-kg car from rest to a speed of v, doing 5.340 3 of work in the process. During this time, the car moves 26.0 m. Neglecting friction between car and road, find v and the horizontal force exerted on the car. (a) the speed v m/s (b) the horizontal force exerted on the car (Enter the magnitude.) according to the major premise of ______________, crime occurs when the wealthy and the poor live close to one another. Anyone know this question? Help me quickkkk!!A = 1/2(a+b)h solve for b Fred Ethridge is a valued employee of a large Canadian company. He is in the process of negotiating a new compensation package for the coming year. As he is looking to purchase a new residence, one of the alternatives that is being considered is an interest free loan that would be used to purchase this property. Fred needs $350,000 to comfortably finance this purchase. As he has an excellent credit rating, the Royal Bank is prepared to extend the $350,000 on a 5 year, closed mortgage at a rate of 4.75 percent. The company has indicated that they will extend a $350.000, 5 year, interest free loan in lieu of a raise. The Company's accounting department will calculate the after tax cost of providing the loan and his employer will offer Fred the alternative of additional salary that has the same after tax cost to the Company. The Company is subject to tax at a combined federal/provincial rate of 29 percent. When funds are available, the Company has alternative investment opportunities that earn a pre-tax rate of 10 percent. Because of Fred's current high salary, any additional compensation will be taxed at a combined federal/provincial rate of 49 percent. Assume that the prescribed rate for the current year is 2 percent. Required: A. Determine the tax consequences to Fred and the cost to the Company, in terms of lost after-tax earnings, of providing Fred with a $350,000 interest free loan for the first year of the loan. B. Determine the amount of additional salary that could be provided to Fred for the same after tax cost to the Company that you calculated in Part A. C. Which alternative would you recommend that Fred accept? Explain your conclusion.