hormones called blank 1 are produced and released by neurons in the brain, rather than by the endocrine glands, and delivered to organs and tissues through the bloodstream.

Answers

Answer 1

Hormones called neurotransmitters are produced and released by neurons in the brain, rather than by the endocrine glands, and delivered to organs and tissues through the bloodstream.

Neurotransmitters are chemicals that act as messengers and are responsible for communication between neurons and other cells in the body. What are hormones? Hormones are chemical messengers that are secreted by endocrine glands and are carried to various organs and tissues in the bloodstream. Hormones regulate and coordinate a variety of physiological processes, including growth and development, metabolism, and sexual function. Hormones are essential for maintaining homeostasis, which is the maintenance of a stable internal environment. When a neuron fires, it releases neurotransmitters, which are chemical messengers that cross the synapse and bind to receptors on other neurons or on organs or tissues. The neurotransmitters then stimulate or inhibit these cells, causing a variety of physiological effects. Neurotransmitters are involved in a variety of physiological processes, including mood, cognition, and behavior. They are also involved in the regulation of the autonomic nervous system, which controls vital functions such as heart rate, breathing, and digestion. Neurotransmitters play an important role in the brain's reward system, which is responsible for the pleasurable feelings associated with activities such as eating. Some drugs, such as cocaine and amphetamines, stimulate the release of neurotransmitters in the brain, leading to feelings of euphoria and pleasure. However, long-term drug use can lead to changes in the brain's reward system, leading to addiction and other adverse effects.

Learn more about neurons: https://brainly.com/question/11538106

#SPJ11


Related Questions

PLS, help me I'm having trouble with this!

PLS, help me I'm having trouble with this!

Answers

Answer:

oopskie

Explanation:

Answer:

Answer is TACGTTTAACGAGTGGCCCCTAGTCGTG

Explanation: ALways remember A=T and C=G

APPLes grow on trees and Carrots grow in the ground

The structure labelled A was marked ×10
and structure B was marked x20. How
much bigger did these structures make
the cells appear?

Answers

Answer:

The structure labelled a was marked 10 and structure b was marked 20 how much bigger did these structures make the cells appear?

What is the nature of soil present in horizon '1'.​

What is the nature of soil present in horizon '1'.

Answers

Answer:

Well since, O horizon is thin in some soils, thick in others, and not present at all in others.

Explanation:

What is the nature of soil present in horizon '1'.


Describe how lymph nodes, bone marrow, and
the spleen help fight off various illnesses.

Answers

Answer:

Explanation:

Lymph vessels send lymph fluid through nodes throughout the body. Lymph nodes are small structures that work as filters for foreign substances, such as cancer cells and infections. They contain immune cells that can help fight infection by attacking and destroying germs that are carried in through the lymph fluid.The tissues and organs that produce, store, and carry white blood cells that fight infections and other diseases. This system includes the bone marrow, spleen, thymus, lymph nodes, and lymphatic vessels (a network of thin tubes that carry lymph and white blood cells)

What is the word equation for photosynthesis?

Answers

Answer:

The photosynthesis equation is as follows: 6CO2 + 6H20 + (energy) → C6H12O6 + 6O2 Carbon dioxide + water + energy from light produces glucose and oxygen.

6CO2 + 6H2O → C6H12O6 + 6O2 ( all the 2’s are small 2’s at the bottom of the letter by the way )

A high-pitched crowing sound from the upper airway results from tracheal or laryngeal spasm and is called what?.

Answers

A high-pitched sound called stridor is connected to laryngeal blockage. There are several congenital causes of laryngomalacia, including laryngeal web, unilateral or bilateral vocal cord palsy, subglottic stenosis, subglottic hemangioma, and tracheomalacia.

What is a strideor ?

When your youngster breathes in, you are most likely to hear strudor, a high-pitched sound (also known as "inspiration"). Your child's upper airway is frequently the source of the obstruction or constriction.

When they breathe in or out, children who have asthma or other respiratory conditions may wheeze or make stridor, a high-pitched, turbulent sound that is less melodic than a wheeze. Typically, stridor is a sign of an obstruction or restriction of the upper airway outside of the chest cavity.

Learn more about Stridor here:

https://brainly.com/question/2056101

#SPJ1

Which genetically modified organism will best prevent farmers from losing their crops during transport to grocery stores?
oranges that have a prolonged shelf life
corn with a high yield
butter squash that have high nutritional value
fruit with a vaccine

Answers

Answer:

Probably oranges that have a prolonged shelf life

if you were asked to build a model of a nucleotide, what structures would you need to represent in the model?

Answers

A phosphate group, a base containing nitrogen, and a base with five carbons in sugar make up a nucleotide.


A nucleotide is made up of a phosphate group, a base that contains nitrogen, and an amino group made up of five carbons from sugar. The structural unit or building block of DNA and RNA is known as a nucleotide. It is made up of a base, which can be any of the following: adenine, thymine, guanine, or cytosine. and two molecules each of phosphoric acid and sugar. The majority of cellular functions are powered by nucleotides, particularly ATP. They are essential for supplying the electron transport chain with electrons. NADH, or nicotinamide adenine dinucleotide, and FADH2, or flavin adenine dinucleotide, are two examples.


To learn more about the nucleotide follow the link: https://brainly.com/question/30299889


#SPJ4

The ____________ of the entire skeleton or skeletal elements utilizes the anchoring of muscles to attachment sites on the bones, which then serve as levers.

Answers

The movement of the entire skeleton or skeletal elements utilizes the anchoring of muscles to attachment sites on the bones, which then serve as levers.

Muscles are anchored to tendon and fibrous connective tissue that attaches muscle to bone. Tendons may also attach muscles to structures such as the eyeball. A tendon serves to move the bone or structure.

Muscles attach to bones at locations called origins and Insertions. A skeletal muscle attaches to bone at two or more places. If the place is a bone that remains immobile for an action, the attachment is called an origin. When your muscle activates or bunches up, it pulls on the tendon. Tendons attach muscles to bones. The tendon pulls the bone and  make it move.

To learn more about Muscles  , here

brainly.com/question/9883108

#SPJ1

What statements are true about glycolysis?

Select all that apply.

It takes place in the mitochondria.
It produces energy in the form of ATP.
It requires oxygen.
Its products can enter other pathways.

Answers

It requires oxygen ..is the answer

1a) Explain the importance of feedback inhibition in metabolic processes such as glycolysis, pyruvate oxidation, citric acid cycle, Calvin cycle, etc. (Please use one process in your explanation to clarify your rationale.) 5 pts 1a.) 1b) What would occur in the cell if the enzyme that regulates the process you explained in 1a were to malfuction? In your explanation, be sure to mention the name of the enzyme and if there are any detrimental physiological effects, for example the development of a certain disorder or disease. 5 pts

Answers

Feedback inhibition is an essential process in the regulation of metabolic pathways. It functions as a critical control mechanism in a cell's metabolism. Feedback inhibition is a form of enzyme regulation in which a molecule, typically the product of a reaction, regulates the rate of the reaction's

subsequent reactions to maintain homeostasis. This inhibition can either be competitive or non-competitive depending on the type of inhibitor produced.

It plays a vital role in regulating metabolic pathways such as glycolysis, pyruvate oxidation, citric acid cycle, and Calvin cycle.The Calvin cycle, which takes place in the chloroplasts of plant cells, is an excellent example of feedback inhibition's importance.

In the Calvin cycle, the enzyme rubisco (ribulose bisphosphate carboxylase/oxygenase) catalyzes the first step of carbon fixation.

However, this enzyme also catalyzes a side reaction in which oxygen is fixed instead of carbon dioxide. This side reaction is known as photorespiration, which is a wasteful process that can reduce plant growth and productivity. Rubisco is regulated by a process known as feedback inhibition.

Feedback inhibition prevents rubisco from catalyzing photorespiration by inhibiting the enzyme when the levels of its product, ribulose-1,5-bisphosphate, are high.

As a result, the enzyme is prevented from catalyzing photorespiration, and carbon fixation is maximized.In the event of a malfunction of the enzyme regulating the process, the cell would experience an accumulation of the product that triggers the inhibition of the enzyme, leading to a decrease in metabolic activity. Rubisco is regulated by a process known as feedback inhibition.

Inhibition is a fundamental aspect of regulating enzyme activity in metabolic pathways. The malfunction of rubisco can lead to reduced plant growth and productivity, making it difficult to produce enough food to sustain human populations.

This could also cause a negative impact on the ecosystem as well. So, the proper functioning of feedback inhibition is critical to maintain metabolic processes.

To know more about Feedback visit;

brainly.com/question/30449064

#SPJ11

Explain how artificial selection could lead to a new plant or animal?

Answers

Artificial selection is the process by which humans choose individual organisms with certain phenotypic trait values for breeding. If there is additive genetic variance for the selected trait, it will respond to the selection, that is, the trait will evolve.

The cell membrane is described as highly selective. It bars the passage of
most but not all substances. What structural feature of the cell membrane acts
like gates that allow certain substances, including water, to pass through?
A permanent gaps in the lipid bilayer
B proteins that temporarily dissolve regions of the lipid bilayer
channels in transmembrane proteins embedded in the lipid bilayer
D channels in phosphate groups at the outer edges of the lipid bilayer

Answers

According to the research, the correct answer is Option C. Channels in transmembrane proteins embedded in the lipid bilayer of the cell membrane acts like gates that allow certain substances.

What is the cell membrane?

It is a structure that surrounds the cell, normally formed by a phospholipid bilayer, also containing proteins and other constituents.

In this sense, Channels in transmembrane proteins of a membrane allow solutes to pass through or provide a passage for water and polar ions, starting at a certain size, depending on the thickness of the membrane and the size of the pores.

Therefore, we can conclude that according to the research, ions and water cross the cell membrane through channels made with proteins.

Learn more about Channels in the cell membrane here: https://brainly.com/question/7446951

#SPJ1

Explain glaucoma and ocular hypertension is extreme detail, I will mark brainliest according to how lengthy, accurate, and helpful it is. please!!!!!!!!!!!!!!

Answers

Glaucoma and ocular hypertension are both eye conditions that affect the intraocular pressure (IOP) within the eye. While they are related, they have distinct characteristics and implications for vision health. Let's delve into each condition in detail:

1. Glaucoma:

Glaucoma is a group of eye diseases that can cause damage to the optic nerve, leading to vision loss or blindness if left untreated. The primary risk factor for glaucoma is increased intraocular pressure (IOP). However, it is important to note that not all individuals with elevated IOP will develop glaucoma, and some individuals with normal IOP can still develop the disease.

Types of Glaucoma:

- Primary Open-Angle Glaucoma (POAG): This is the most common form of glaucoma, characterized by a gradual increase in IOP due to poor drainage of fluid (aqueous humor) from the eye.

- Angle-Closure Glaucoma: In this type, the drainage angle between the iris and cornea becomes blocked or narrow, causing a sudden increase in IOP.

- Normal-Tension Glaucoma: In this variant, the optic nerve is damaged even though the IOP remains within the normal range.

Symptoms and Diagnosis:

Glaucoma often progresses silently without noticeable symptoms until the later stages. As a result, regular comprehensive eye exams that include measuring IOP and evaluating the optic nerve are crucial for early detection. Symptoms may include peripheral vision loss, blurred vision, eye pain, and halos around lights in some cases.

Treatment:

Treatment for glaucoma aims to lower IOP and prevent further damage to the optic nerve. This can involve various approaches, including:

- Medications: Eye drops or oral medications that reduce IOP by increasing fluid drainage or decreasing fluid production.

- Laser Therapy: Laser trabeculoplasty or iridotomy can help improve fluid drainage.

- Surgery: In severe cases, surgical procedures like trabeculectomy or drainage implants may be necessary to lower IOP.

2. Ocular Hypertension:

Ocular hypertension refers to a condition characterized by elevated intraocular pressure without optic nerve damage or vision loss. It is considered a potential risk factor for the development of glaucoma, but not everyone with ocular hypertension will progress to glaucoma.

Causes:

Ocular hypertension occurs when the production or drainage of aqueous humor within the eye is disrupted, leading to an increase in IOP. The exact cause may vary and can be influenced by factors such as age, genetics, certain medications, and underlying eye conditions.

Diagnosis and Monitoring:

Ocular hypertension is typically detected during a routine eye exam when IOP measurements are higher than normal (normal range: 10-21 mmHg). Additional tests, such as visual field tests and optic nerve evaluation, are performed to assess the risk of developing glaucoma.

Treatment:

Since ocular hypertension does not necessarily result in glaucoma, the approach to management may differ. Options may include:

- Observation: Regular monitoring of IOP and optic nerve health to detect any signs of glaucoma development.

- Medications: In some cases, eye drops may be prescribed to lower IOP and reduce the risk of glaucoma.

- Lifestyle Changes: Adopting a healthy lifestyle, avoiding smoking, and maintaining overall eye health can help manage ocular hypertension.

It is essential for individuals with ocular hypertension to follow up regularly with their eye care professional to ensure close monitoring and timely intervention if necessary.

In summary, glaucoma is a progressive eye disease that causes optic nerve damage and vision loss, often associated with increased IOP. Ocular hypertension, on the other hand, refers to elevated IOP without optic nerve damage. While ocular hypertension is a risk factor for gl

The estimated percentage of cancers that are due to poor diet and lifestyle habits is approximately Group of answer choices3/41/21/31/4

Answers

Solution:

A large body of literature indicates that 30% to 40% of all cancer cases are related to poor dietary or lifestyle habits.

That is equivalent to 1/3.

So that the correct answer is:

1/3

Pseudohypertrophic muscular dystrophy is an inherited disorder that causes gradual deterioration of the muscles. It is seen almost exclusively in boys born to apparently normal parents and usually results in death in the early teens. Is this disorder caused by a dominant or recessive allele? Is its inheritance sex-linked or autosomal? How do you know? Explain why this disorder is almost never seen in girls.Recessive; if the disorder were dominant, it would affect at least one parent of a child born with the disorder. The disorder's inheritance is sex-linked because it is only seen in boys. For a girl to have the disorder, she would have to inherit recessive alleles from both parents. This would be very rare, since males with the recessive allele on their X chromosome die in their early teens.

Answers

Pseudohypertrophic muscular dystrophy is an inherited Recessive disorder.

If the disorder were dominant, at least one parent of a child who was born with the disorder would be affected. As it only affects boys, the disorder is inherited in a sex-linked manner. It would take recessive alleles from both parents for a girl to inherit the disorder. Given that males with the recessive allele on their X chromosome usually pass away in their early teens, this would be extremely uncommon.

Define Pseudohypertrophic muscular dystrophy .

Gowers first highlighted the familial nature of PROGRESSIVE muscular dystrophy shortly after it was first identified more than a century ago. The disease, which has comparable symptoms in affected family members, might differ in its route of inheritance and clinical features from kindred to kindred. The most prevalent variant, first identified by Duchenne in 1868, is passed on as an X-linked recessive trait. These affected males typically begin to have muscle weakness in their pelvic femoral muscles before the age of six, experience rapid progression of their muscle weakness, develop pseudohypertrophy of the calves, become chair-bound by the age of twelve, and pass away by the age of twenty.

To know more about Pseudohypertrophic muscular dystrophy use link below:

https://brainly.com/question/11880421

#SPJ4

name at least 3 environmental habitats that would facedestruction if the trees on the trail were all clear cut

Answers

Clearcutting disturbs soils, wetlands, and peatlands, releasing their vast carbon stores, and diminishes the boreal forest's ability to sequester carbon from the atmosphere. As such, it is often an ecologically harmful form of logging.

the higher plant symbiont benefits from the mycorrhizal relationship by principally obtaining which of the following from the fungus.

Answers

Mycorrhizal relationships are mutualistic relationships between fungi and plant roots. The fungus forms a network of hyphae that is much larger than the roots of a single plant. In this way, the fungus can help plants access nutrients that would otherwise be unavailable.

Most fungi get carbohydrates from plants in exchange for nutrients that they've gathered. A mycorrhizal relationship is a good example of this. The fungus gets carbohydrates from the plant, which it uses for energy. In return, the fungus helps the plant absorb water and nutrients from the soil.

Because of the mycorrhizal relationship, plants are able to access nutrients that would otherwise be unavailable to them. The fungus is also able to get carbohydrates that it wouldn't be able to get otherwise. This makes the mycorrhizal relationship a very beneficial one for both parties involved.

To know more about mutualistic visit:

https://brainly.com/question/28041405

#SPJ11

PLEASE HELP BRAINLY IF CORRECT
Which diagram shows the most likely effect when a rock is weathered by
water flowing over its entire surface?

PLEASE HELP BRAINLY IF CORRECTWhich diagram shows the most likely effect when a rock is weathered bywater

Answers

Answer:

B remember when you take a rock from a river it's smooth

The answer is B just got it right.

What causes soil to wash or blow away more easily because soil is not stabilized by plant roots?

Choices are :
A) biological weathering
B) deposition
C) random weathering
D) chemical weathering
E) physical weathering

Answers

Answer:

Is this a multiple choice?

Explanation:

A. Biological Weathering

if multiple choice

E. Physical Weathering

A. Biological Weathering

D. Chemical Weathering

Why are inferences a vital part of the scientific process?

They are the facts and patterns that are studied.
They are foundations for hypotheses.
They are the data that supports a claim.
They are conclusions based on facts.

Answers

Inferences are referred to as reasonable conclusions drawn based on past experiences, observations, and knowledge. It's a calculated guess that can lead to developing an hypothesis.

Inferences are a vital part of the scientific process as they are they are conclusions based on facts (option D).

As earlier stated they are very vital in the scientific process. This is because studying the facts and patterns observed enables a conclusion to be drawn (inference) and an hypothesis to be developed and allows for further studies.

Learn more about inferences in scientific process: https://brainly.com/question/10699301

jason was fishing in the river and while reeling in the fish on his line, a shark jumped out and ate his fish. how was a shark, that lives in the ocean, able to live in the water of the river?

Answers

It seems that the scenario you described involves a shark living in a river, which is usually associated with freshwater, while most sharks are known to inhabit saltwater environments such as oceans. The key term to understand this phenomenon is "brackish water."

Brackish water is a mix of both freshwater and saltwater, typically found in estuaries where rivers meet the ocean. Some species of sharks, such as bull sharks, have the unique ability to adapt to varying salinity levels in their environment, which allows them to swim from saltwater to freshwater areas.


Osmoregulation is the process by which an organism maintains the balance of water and ions in its body. In the case of bull sharks, they have specialized kidneys that can filter out excess salt when they are in freshwater or retain more salt when they are in saltwater.



It could have swum up the river from the ocean, entering the freshwater environment in search of food, like the fish Jason was reeling in. This unique ability to adapt to different salinity levels is what makes some shark species able to live in both ocean and river waters.

Know more about shark   here:

https://brainly.com/question/28490007

#SPJ11

the term now used to describe those who expect and intend to remain nonparents is

Answers

The term now used to describe those who expect and intend to remain nonparents is childfree.

The term childfree is used to indicate the decision of an individual or a couple to remain without any children. It's a lifestyle decision that is often chosen by people who have various reasons for not wanting to have children, such as personal preferences, financial constraints, health problems, or environmental concerns. Childfree people may have decided not to have children due to different reasons that may include, personal preference, health, lack of desire, or environmental concerns, among others. While the term childfree is different from childless, it is sometimes used interchangeably to describe people without children. Childless people often wish to have children but are unable to, while childfree people have made the decision not to have children. There is often a social stigma attached to childfree individuals, who may face criticism or social pressure for their decision to remain childless.

However, many people who choose to be childfree lead happy and fulfilling lives without having children.

know more about childfree

https://brainly.com/question/5984017

#SPJ11

telomeres serve as caps protecting the ends of linear chromosomes. which of the following is false regarding the replication of telomeric sequences? a. the lagging-strand telomeres are not completely replicated by dna polymerase. b. telomeres are made of repeating sequences. c. additional repeated sequences are added to the template strand. d. the leading strand telomeres are not completely replicated by dna polymerase. e. all of the above are true

Answers

False regarding the replication of telomeric sequences is Option d. The leading strand doubles back on itself to form a primer for the lagging strand.

A telomere is a place of repetitive nucleotide sequences related to specialized proteins on the ends of linear chromosomes. although there are special architectures, telomeres, in a vast feel, are a large genetic function most generally determined in eukaryotes.

Telomeres are structures crafted from DNA sequences and proteins found on the ends of chromosomes. They cap and protect the top of a chromosome just like the cease of a shoelace. In nearly all animals, from the best to the maximum complicated, telomeres are required for the mobile department.

Learn more about telomeres here:-https://brainly.com/question/5896537

#SPJ4

If you move point C toward point B along , how does change? How do and change? What happens to these angles if you move point C back away from point B along ?

Answers

If we take point C closer towards point B, then  ∠ABC will remain the same, the measurement of ∠BAC will decrease, and the measurement of ∠ACB will increase. Similarly, If we take point C far from point B, ∠ABC will remain the same, the measurement of ∠BAC will increase, and the measurement of ∠ACB will decrease.

Angle is formed by two lines or rays which have a common endpoint. Angle has two sides.

Here Given in the question that Point C is movable and it moves towards point B.

If we change the position of C nearer to point B keeping points B and A fixed in angle ∠ABC the side BC length will decrease but the gap between AB and BC will remain the same.  Therefore ∠ABC will remain the same.

If we change the position of C nearer to point B keeping point B and A fixed in angle ∠BAC, point C will get closer to point B for which the gap between AB and AC will decrease. Therefore the measurement of ∠BAC will decrease.

If we change the position of C nearer to point B keeping points B and A fixed in angle ∠ACB, point C will get far from point A as point A is fixed for which the gap between AC and CB will increase. Therefore the measurement of ∠ACB will increase.

Therefore if we take point C closer towards point B, then  ∠ABC will remain the same, the measurement of ∠BAC will decrease, and the measurement of ∠ACB will increase.

If we take point C far from point B, then the thing will be reversed except ∠ABC.

Therefore If we take point C far from point B, ∠ABC will remain the same, the measurement of ∠BAC will increase, and the measurement of ∠ACB will decrease.

Learn more about the angle here:

brainly.com/question/788198

#SPJ9

2. What happens to the rabbit population each time there is an increase in the lynx population?

Answers

Answer:

For each increase in the lynx population, there is an decrease in the rabbit population.

Explanation:

For each lynx, there is a certain demand for rabbit; as each generation of the lynx increases, there is a greater demand.

in paragraph 7, orenstein reports on two studies of primates. what conclusion does this evidence support? what conclusion does lise eliot's research (para. 9) support?

Answers

Conclusion that this evidence support gave is important characteristics of evidence analysis are: It should be logical and self-sustaining and The conclusions and interpretations should be convincing.

It should support the audit observation, Provides basis of arguments against the best possible counter argument. The analysis may be in the form of Cause and effective studies;  Before and after studies; Process studies; Comparative studies; etc.

Evidence gathered leading to audit findings stand the test of their sustainability assured by the standards of their competence, relevance and sufficiency (reasonableness).

To know more about evidence here

https://brainly.com/question/375033

#SPJ4

why amylose doesn't form a gel when hot water is added? can someone explain​

Answers

Amylose is less soluble in water. It does not form a gel when hot water is added. Amylose constitutes about 20-30% of the starch. Amylose can be hydrolyzed with α amylase and β amylase enzymes completely.
Because it’s less soluble in water

Explain how the structure of an enzyme can affect its function.

Answers

Explanation:

i hope the answer will help you !

Explain how the structure of an enzyme can affect its function.

what condition can occur with a jones fracture due to its poor blood supply?

Answers

A Jones fracture is a specific type of foot fracture that occurs in the fifth metatarsal bone near the base of the small toe. Due to its poor blood supply, a possible condition that can occur with a Jones fracture is delayed or non-union healing, where the bone fails to heal properly or takes longer than usual to heal. This is because the limited blood supply can impede the delivery of essential nutrients and oxygen needed for effective bone repair and regeneration.

A Jones fracture is a specific type of fracture that occurs in the fifth metatarsal bone of the foot, near its base. This region of the bone has a relatively poor blood supply, which can impede the healing process. When a fracture happens in this area, the limited blood flow can lead to inadequate delivery of oxygen and nutrients to the fractured site, affecting bone healing. As a result, the fracture may take longer to heal than other types of fractures or may fail to heal altogether, leading to delayed union or nonunion. Treatment for a Jones fracture often involves immobilization, possibly with the use of a cast or a walking boot, and in some cases, surgical intervention may be necessary to promote healing and stabilize the fracture.

Know more about fracture here:

https://brainly.com/question/31937614

#SPJ11

Other Questions
A bag contains 10 red marbles, 7 white marbles, and 8 blue marbles. You draw 3 marbles out at random, without replacement. Give all answers as a decimal rounded to four places. a) What is the probability that all the marbles are red? The probability that all the marbles are red is b) What is the probability that exactly two of the marbles are red? The probability that exactly two of the marbles are red is c) What is the probability that none of the marbles are red? The probability of picking no red marbles is Manufacturing overhead applied$150,000Actual amount of manufacturing overhead costs120,000Amount of overhead applied during the year that is in:Work in Process$37,50025%Finished Goods52,50035%Cost of Goods Sold60,00040%Total overhead applied$150,000100%Knowledge Check 01If the Manufacturing Overhead account is closed to Cost of Goods Sold, the related entry will ________.decrease the cost of goods sold by $30,000increase the cost of goods sold by $30,000decrease the cost of goods sold by $150,000increase the cost of goods sold by $150,000 cash receipts a firm has actual sales of $70,000 in april and $61,000 in may. it expects sales of $71,000 in june and $96,000 in july and in august. assuming that sales are the only source of cash inflows and that half of them are for cash and the remainder are collected evenly over the following 2 months, what are the firm's expected cash receipts for june, july, and august? Given the function f(x, y) =3 x + 3 y on the convex region defined by R= = {(x, y): 6x + 4y < 48, 4x + 4y < 40, x > 0,y>0} (a) Enter the maximum value of the function (b) Enter the coordinates (x, y) 15x - 5y = 30. solve for y (please help!!) a graph titled monthly sales and advertising costs has advertising costs (1,000 dollars) on the x-axis and sales (1,000 dollars) on the y-axis. a line goes through points (6.4, 117) and (6.6, 120).the scatterplot and trend line show a positive correlation between advertising costs and sales.the slope was found using the points (6.4, 117) and (6.6, 120). what is the value of b in the equation of the trend line?y Find the approximate value I of the integral ^3_0 f(x)dx using the Trapezoidal rule with n= 3, where f(x) = x(1+e^x). If ^3_0 f(x)dx-1 = -3/12 f"(c) where 0 < c how does Hoover's actions were the catalyst for a greater economic depression? greek colonization a. resulted from overpopulation, an increase in trade, and a widening gap between rich and poor. b. brought to an end the hopes of those who were prospering from expanded commercial activities. c. ended rule of tyrants who had the support of those opposed to the oligarchic aristocracy. d. failed to extend into imperial control over thrace in the balkan peninsula and the mediterranean island of cyprus. e. extended into northern britain. In the research context, the term validity most commonly refers to: Whether operationalized terms actually measure what they purport to measure. A triangular swimming pool measures 41 feet on one side and 64 feet on another side. These sides form an angle that measures 50. To the nearest tenth of a foot, how long is the third side? the nurse is caring for an infant born to a woman with diabetes. the nurse notes that the infant moves the left arm, but the right arm remains flaccid. what order does the nurse anticipate? the long run elasticity of the demand for oil is estimated to be -0.5. which of the following statements is/are correct. choose all that apply. group of answer choices A. if oil prices rise by 4%, the quantity of oil demanded will fall by 8%. B. oil is an inferior good. C. if oil prices fall by 10%, quantity of oil demanded will rise by 5%. D. if oil prices rise, oil companies will enjoy higher revenues. E. if oil prices rise, oil companies will lose revenues. F. if oil prices fall, oil companies will enjoy higher revenues. G. if oil prices fall, oil companies will lose revenues. H. the demand for oil is inelastic. Which of the following muscles is the prime abductor of the arm at the shoulder joint?a. Pectoralis major m.b. Latissimus dorsi m.c. Pectoralis minor m.d. Deltoid m. Explain what is wrong with the statement. If 0 = f (x) = g(x) and g(x) dx diverges then by the comparison test so f(x)dx diverges. x O If 0 Which symbol represents enthalpy? qHelp ASAP :( find f (1) f(-3) and f(0) forf(x)2x-7 f(x)=3x^2-5 samuel is a math professor and loves his job. students love his classes because he makes the classes interactive and innovative. even students who score low in math show a remarkable improvement when assigned to his classes. in this scenario, the fact that samuel naturally elicits a strong liking for math from his students exemplifies: a. evocation. b. a false positive. c. aggregation. d. a strong situation. which of the statements can be concluded from gregor mendel's experiments with pea plants? alleles of different genes are inherited independently of each other. for a given trait, two heterozygous parents produce offspring with three possible phenotypes. only one allele determines the phenotype in heterozygous individuals. the pair of alleles for each gene stay together during gamete production. Which statement best describes the effects on the graph of f(x) = 1 over x, when f(x) is replaced by f(x 1) + 4?