HELP ME PLEASEEEEEEE I WILL GIVE POINTS AND BRAINLIEST

HELP ME PLEASEEEEEEE I WILL GIVE POINTS AND BRAINLIEST

Answers

Answer 1
The answer is < A hope this helps

Related Questions

need help will give brainlist

need help will give brainlist

Answers

The table that represents a linear function is table B.

Which table represents a linear function?

A general linear function can be written as:

y = ax + b

Here we can see that for a increase of 1 unit in x, we have a constant increase/decrease of y (which is equal to a).

Only with that we can rule out the tables A, C, and D (C and D because we can see increases and decreases in the y-values).

And table A can be discarded because we have increases of 1 unit in x, but the increases in y aren't equal.

So the only remaining option is B.

Where we can see that as x increases, also does y.

Learn more about linear equations

https://brainly.com/question/1884491

#SPJ1

f(x)
= x + 2
g(x) = 3x + 3
Find (f•g)(-6)

Answers

Answer:

(-4*-15) = 60

What is the result of isolating x² in the equation below?
(x+1)² + (y-8)² = 9
OA. x²=-y²-2x+16y-56
OB. x² = y² +2x+16y+56
C. x = -² -56
D. * = y² +56

Answers

The required result of the identity is \(x^{2} =-y^{2}-2x+16y-56\).

To isolate the algebraic expression given below we need to simplify it and then make \(x^{2}\) the subject of the equation,

For that we must know the identity \((a+b)^{2}=a^{2}+2ab+b^{2}\).

We will break the given equation on the basis of the given identity.

Now, \((x+1)^{2} +(y-8)^{2}=9\\\)

     ⇒\(x^{2} +2x+1+y^{2}-16y+64=9\\\)

     ⇒ \(x^{2} =-y^{2}-2x+16y-56\)

So, the required result of isolating the above given equation is as above.

The correct answer is option B.

To learn more about the algebraic expression and identities visit the link :

https://brainly.com/question/16857438

#SPJ9

Marc Gasol scored 18 points on Monday, 29 points on Wednesday, and 8 points on Saturday. What
​was his average number of points per game for those three nights?

Answers

Answer: 18.33 ppg

Step-by-step explanation:

He played three games

18+29+8=55

55/3=18.33


A committee has fourteen members. There are two members that currently serve as the board's chairman
and ranking member. Each member is equally likely to serve in any of the positions. Two members are
randomly selected and assigned to be the new chairman and ranking member. What is the probability of
randomly selecting the two members who currently hold the positions of chairman and ranking member and
reassigning them to their current positions?
...

Answers

Probability of randomly selecting two members who currently hold positions of chairman and ranking member and reassigning them to their current positions from a committee of 14 members is (1 /182).

As given,

Total members in the committee=14

Number of members serve as chairman and ranking member=2

Total number of ways to assigned new position

=¹⁴P₂

=(14!) / (14-2)!

=(14 × 13 × 12!) / 12!

=14 ×13

=182

Each member is equally likely to serve in any of positions.

Each position there is only one way to reassign position.

Probability of randomly selecting two members = 1 /182

Therefore, probability of randomly selecting two members who currently hold positions of chairman and ranking member and reassigning them to their current positions from a committee of 14 members is (1 /182).

Learn more about probability here

brainly.com/question/11234923

#SPJ1

Find the circumfrance and the area of a circle with a 5 ft radius. Use the value 3.14

Answers

Answer:

Circumference is 2piR =31.4

Area is pir^2=78.5

Step-by-step explanation:

Each side length of a triangle is 4 cm. What type of triangle is it?
☐ right
□acute
Equilateral
Isosceles

Answers

Answer: Equilateral

Step-by-step explanation:

It's equilateral because it says that each side of the triangle is 4cm. In simple words, all the sides of triangle are equal. Such a triangle is called an equilateral triangle.

Hope you understood.

Patrick's gross earnings for the week are $1592.45. His deductions comprise 26% of his total compensation. What is his net pay? Enter your answer rounded to the nearest cent, such as: $4253.64.

Answers

Pretty sure it’s $1560.60

Patrick's net income will be equal to $1178.41.

What is the percentage?

The Percentage is defined as representing any number with respect to 100. It is denoted by the sign %. The percentage stands for "out of 100." Imagine any measurement or object being divided into 100 equal bits.

Given that Patrick's gross earnings for the week are $1592.45. His deductions comprise 26% of his total compensation.

Patrick's net income will be calculated as below:-

26% of $1592.45 = 1592.45 x ( 26 / 100 ) = 414.037

Subtract the deduction from the gross amount:-

Net income = 1592.45 - 414.037 = $1178.41

Therefore, Patrick's net income will be equal to $1178.41.

To know more about percentages follow

https://brainly.com/question/24304697

#SPJ2

For what values is the function g(x) = \(\frac{6}{x(x-7)}\) undefined?

Answers

At x = 0 and x = 7, the function g(x) is undefined.

What is an expression?

Mathematical expression is defined as the collection of the numbers variables and functions by using operations like addition, subtraction, multiplication, and division.

Given that;

The expression of the function is,

⇒ g (x) = 6 / x (x - 7)

Now, We know that;

The function f(x) = a(x) /b (x) is not defined at b (x) ≠ 0

Here, The expression of the function is,

⇒ g (x) = 6 / x (x - 7)

So, Function g (x) is not defined when,

x (x - 7) = 0

⇒ x = 0

or, x - 7 = 0

⇒ x = 7

Thus, At x = 0 and x = 7, the function g(x) is undefined.

Learn more about the mathematical expression visit:

brainly.com/question/1859113

#SPJ1

The formula for the area of a circle is A = ar2 where A is the area ander is the radius.
Estimate the area of a circle where it = 3.142 and r = 8.6 cm.​

Answers

Answer:

The area of circle is 232.23 cm²

Step-by-step explanation:

The formula used to calculate area of circle is: \(\mathbf{A=\pi r^2}\)

Where \(\pi\) = 3.14 and r is radius

We are given radius r = 8.6 cm

We need to find area of circle.

Using formula and finding area of circle

\(A=\pi r^2\\A=3.14\times(8.6)^2\\A=3.14\times 73.96\\A= 232.23 \ cm^2\)

So, the area of circle is 232.23 cm²

Each endpoint of a side of a polygon is
called a ___.

a. diagonal.
b. vertex
c.corner

Answers

The endpoint of a side of a polygon is called a___ the answer is B

Answer:

B. vertex

Step-by-step explanation:

Vertex, Vertices. each endpoint of a side of a polygon. Convex. a polygon such that no line containing a side of the polygon contains a point in the interior of the polygon.

Also can u pls mark me brainliest

Determine the rational zeros for the function f(x)=8x^(3)-6x^(2)-23x+6.
a. -(1)/(2),(1)/(4),2
c. -1(1)/(2),(1)/(4),2
b. 1(1)/(2),(1)/(4),-2
d. -1(1)/(2),-(1)/(4),2

Answers

Answer:

Step-by-step explanation:

Determine the rational zeros for the function f(x)=8x^(3)-6x^(2)-23x+6. a. -(1)/(2),(1)/(4),2 c. -1(1)/(2),(1)/(4),2

Please answer this correctly I only have a little bit of time

Please answer this correctly I only have a little bit of time

Answers

Answer:

1.Commutative

2.Associative

3.Distributive

4.Double Negative

Step-by-step explanation:

Hope this helps! :)

Answer:

1.commutative2.associative3.distributive4.double negetive
Please answer this correctly I only have a little bit of time
Please answer this correctly I only have a little bit of time
Please answer this correctly I only have a little bit of time
Please answer this correctly I only have a little bit of time
Please answer this correctly I only have a little bit of time

What is the probability that a respondent chosen at random is a male or a​ female?

Answers

Answer:

%50

Step-by-step explanation:

%50 male - %50 female

PLS HELP!!!

The number of hours a student spent studying each week for 9 weeks is shown.


9, 4.5, 8, 6, 9.5, 5, 6.5, 14, 4


What is the value of the range for this set of data?


4

14

6.5

10

Answers

Answer: Mean x¯¯¯

7.3888888888889

Median x˜

6.5

Mode 9, 4.5, 8, 6, 9.5, 5, 6.5, 14, 4

Range 10

Minimum 4

Maximum 14

Count n 9

Sum 66.5

Quartiles Quartiles:

Q1 --> 4.75

Q2 --> 6.5

Q3 --> 9.25

Interquartile

Range IQR 4.5

Outliers none

Step-by-step explanation:

carpet is sold in square yards how much carpet would a person need to buy for a rectangle that has dimensions of 10 yards by 18 feet

Answers

A person would need to buy 60 square yards of carpet for a rectangular room with dimensions of 10 yards by 18 feet.

How to determine the amount of carpet needed for a rectangular room?

To determine the amount of carpet needed for a rectangular room, you need to convert the measurements to the same unit of measurement. Since the carpet is sold in square yards, we need to convert the dimensions of the room to yards.

The length of the room is given in yards, so we don't need to make any conversions for that dimension. However, the width of the room is given in feet, so we need to convert it to yards by dividing by 3 (since there are 3 feet in a yard),

18 feet ÷ 3 feet/yard = 6 yards

So the dimensions of the room in yards are 10 yards by 6 yards.

To find the total area of the room, we need to multiply the length and width,

10 yards × 6 yards = 60 square yards

Therefore, a person would need to buy 60 square yards of carpet for a rectangular room with dimensions of 10 yards by 18 feet.

Learn more about rectangle here,

https://brainly.com/question/25292087

#SPJ9

Write and solve an equation.

A drink and 7 pizzas cost $94.25. The cost of the drink was $1.50. What was the cost, c, of one pizza?

Answers

Answer:

13.25

Step-by-step explanation:

1. you have to subract the cost of the drink:

94.25-1.50=92.75

2.you have to divide to get the individual cost of pizzas by doing

92.75÷7=13.25

so therefore your answer is 13.25 per pizza

Help please fast the format is Y-____=_____(x - ____) and i need the actual answer

Help please fast the format is Y-____=_____(x - ____) and i need the actual answer

Answers

9514 1404 393

Answer:

y -195 = 15(x -9)$60

Step-by-step explanation:

The form of the equation you are given is called "point-slope" form. The "slope" in this case is the per-hour fee. The point is (9 h, $195). Point-slope form generally looks like this:

  y -k = m(x -h) . . . . . line with slope m through point (h, k)

Here, you have m=15, (h, k) = (9, 195), so the equation looks like ...

  y -195 = 15(x -9)

__

The "one-time fee" is the cost when hours are zero.

  y -195 = 15(0 -9)

  y = 195 -9(15) = 60 . . . . add 195 to both sides, and evaluate

The one-time fee is $60.

The largest frog in the world is the goliath, It can grow to be 12 inches long. The smallest frog in the world is about 2.5% as log as the goliath. About how long is the smallest frog in the world

Answers

Answer:

0.3 inches

Step-by-step explanation:

2.5% = 0.025

The smallest frog is 12 * 0.025 inches, which is 0.3 inches.

(12x+5)°=(17x-5)°
Find x=?

(12x+5)=(17x-5)Find x=?

Answers

Step-by-step explanation:

(12x+5)=(17x-5)

5+5=17x-12x10=5xx=10/3x=2

stay safe healthy and happy.

2. Which equation has no solution? *
1 poir
O x-5(x + 4) = 2(2x + 7) + 6
O 5(x + 1) - 3x = 5 - 2(5 - x)
O 1 - 3(x + 3) = 2(3x – 4) - 9x
O 3(x - 4) + x = 4(3 - x)

Answers

Answer:

5(x+1) - 3x = 5 - 2(5-x)

Step-by-step explanation:

This has no solution. Explanation:

5(x+1) - 3x = 5 - 2(5-x)

5x + 5 - 3x = 5 -10 + 2x

2x + 5 = -5 + 2x

5 = -5

From the result above, clearly there is no x to satisfy the equation, because 5 (to the left) can never be the same as -5 (to the right).

what is C(8,5) in factorial notation?

Answers

Answer:

The formula for the number of combinations of n objects taken r at a time is given by:

C(n, r) = n! / (r! * (n-r)!)

In this case, we have:

C(8, 5) = 8! / (5! * (8-5)!)

Simplifying the denominator:

C(8, 5) = 8! / (5! * 3!)

Writing 5! and 3! in expanded form:

C(8, 5) = 8! / (5 * 4 * 3! * 3 * 2 * 1)

Cancelling out the 3! terms:

C(8, 5) = 8! / (5 * 4 * 3 * 2 * 1)

Writing 8! in expanded form:

C(8, 5) = (8 * 7 * 6 * 5 * 4 * 3 * 2 * 1) / (5 * 4 * 3 * 2 * 1)

Cancelling out the 5 * 4 * 3 * 2 * 1 terms:

C(8, 5) = 8 * 7 * 6 / (3 * 2 * 1)

Simplifying:

C(8, 5) = 56

Therefore, C(8, 5) = 56 in factorial notation.

15r-15s=
can you help

Answers

Answer:

=15r−15s

or if it is a factor:

15(r−s)

In a diagram, ∠A and ∠B are vertical angles, and ∠B is a complementary angle with ∠C. If ∠A=22°, write an equation that you can use to solve for ∠C.

Answers

Answer:

22° + m<C = 90°

Step-by-step explanation:

Pre-Solving

We are given that <A (which is equal to 22°) and <B are vertical angles, and that <B is complementary to <C.

We want to write an equation that will help us solve <C.

Solving

Recall that vertical angles are congruent by vertical angles theorem.

This means that <A ≅ <B; it also means that the measure of <B is also 22°.

Also recall that complementary angles add up to 90°.

This means that m<B + m<C = 90°.

Since we deduced that m<B is 22°, we can substitute that value into the equation.

Hence, an equation that can be used to solve for <C is:

22° + m<C = 90°

09.
If X = 12, Y = ¹/3, and T = 6
Evaluate XY - YT.

Answers

Answer:

XY - YT = 2

Step-by-step explanation:

substitute the given values into the expression

XY - YT

= (12 × \(\frac{1}{3}\) ) - (\(\frac{1}{3}\) × 6 )

= 4 - 2

= 2

What additional information would allow you to prove the quadrilateral is a parallelogram according to the minimum criteria?
Question 5 options:

A)

||

B)



C)



D)

∠F ≅ ∠H

What additional information would allow you to prove the quadrilateral is a parallelogram according to

Answers

The additional information would allow you to prove the quadrilateral is a parallelogram according to the minimum criteria is

EJ ≅ GJ. Option A

How to prove the statement

We need to know the properties of a parallelogram, we have;

Opposite sides are parallel.Opposite sides are congruent.Opposite angles are congruent.Same-Side interior angles (consecutive angles) are supplementary.

We know that FJ  ≅ JH, it's given by the marks, now if it were to happen that EJ ≅ GJ, that would mean that the diagonals on that quadrilateral are bisecting each other, and if that's so, then the quadrilateral it's indeed a parallelogram.

Learn more about quadrilaterals at: https://brainly.com/question/23935806

#SPJ1

The complete question:

What additional information would allow you to prove the quadrilateral is a parallelogram according to the minimum criteria?

A)

ej ≅ gj

B)

ej || gj

C)

fg || eh

D)

ef ≅ hg

find the surface area of the net
ILL MARK AS BRAILIEST

find the surface area of the netILL MARK AS BRAILIEST

Answers

Answer:

200

Step-by-step explanation:

Surface are of cube = 6a^2

\Ih -what is the square root of 14161​

Answers

Answer:

The answer is 119

Step-by-step explanation:

Answer:

119

Step-by-step explanation:

There is a reason why the answer is 119

First, lets take a look at your perfect squares chart ( by tens )

10 x 10 = 100

20 x 20 = 400

30 x 30 = 900

40 x 40 = 1600

50 x 50 = 2500

60 x 60 = 3600

70 x 70 = 4900

80 x 80 = 6400

90 x 90 = 8100

100 x 100 = 10000

110 x 110 = 12100

120 x 120 = 14400

we know that 12100 < 14161 < 14400, so it has to be in between the square root of 110 and the square root of 120

111 x 111 = 12321

112 x 112 = 12544

113 x 113 = 12769

114 x 114 = 12996

115 x 115 = 13225

116 x 116 = 13456

117 x 117 = 13689

118 x 118 = 13924

119 x 119 = 14161

We found out that the square root of 119 = 14161

Therefore, the square root of 119 = 14161

If you want to find out a quicker way to do this, comment me below

Micaela and Trevon are selling wrapping paper for a school fundraiser.



Customers can buy rolls of plain wrapping paper and rolls of holiday wrapping paper.



Micaela sold 2 rolls of plain wrapping paper and 1 roll of holiday wrapping paper for a total of $37.28. Trevon sold 7 rolls of plain wrapping paper and 7 rolls of holiday wrapping paper for a total of $182.28.



What is the cost each of one roll of plain wrapping paper and one roll of holiday wrapping paper?

Answers

Using a system of equations, it is found that:

One roll of plain wrapping paper costs $11.24.One roll of holiday wrapping paper costs $14.80.

-------------------------

For the system of equations, we consider the cost of a roll of plain wrapping as x and the cost of a roll of holiday wrapping as y.2 rolls of plain wrapping paper and 1 roll of holiday wrapping paper for a total of $37.28, thus:

\(2x + y = 37.28 \rightarrow y = 37.28 - 2x\)

Trevon sold 7 rolls of plain wrapping paper and 7 rolls of holiday wrapping paper for a total of $182.28, thus:

\(7x + 7y = 182.28\)

Simplifying everything by 7.

\(x + y = 26.04\)

-------------------------

Considering \(y = 37.28 - 2x\)

\(x + 37.28 - 2x = 26.04\)

\(x = 11.24\)

\(y = 37.28 - 2(11.24) = 14.80\)

One roll of plain wrapping paper costs $11.24.

One roll of holiday wrapping paper costs $14.80.

A similar problem is given at https://brainly.com/question/17191037

Which of the four is it? ​

Which of the four is it?

Answers

Answer:

option 1 i believe

Step-by-step explanation:

just worked it out

i hope this is right and helps <3

Which of the four is it?
Other Questions
In order for the characteristics of a sample to be generalized to the entire population, the sample should be: O symbolic of the population O atypical of the population representative of the population illustrative of the population Cumulative Exam ReviewActiveRead the excerpts.From A Feeding Study about Cats by Daniel CohenA team of researchers has discovered that cats thateat once a day are healthier and more satisfied thancats that are fed multiple times a day. The teamstudied eight healthy indoor cats over three weeks.Some of the cats were fed once a day, while otherswere fed four times a day. The researchers observedthe cats' activity levels each day. They alsomeasured the cats' body weights and the levels ofvarious chemicals in their blood. The data showedthat the cats that ate once a day were less hungryand had more protein in their blood, suggesting thatthey are better able to build and maintain muscle.The researchers found that neither group gainedweight during the study.From Responsible Cat Ownership by Navita GuptaMark this and return What choice best explains how the authors'purposes are similar in both passages?Both authors describe the best food to feed cats.Both authors describe reasons cats gain weightBoth authors explain methods for keeping catshealthy.Both authors explain why active cats should eatmore. The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below: AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTCT CTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAGHow many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI? a. two b. three c. four d. five A random sample of size 64 is to be used to test the null hypothesis that for a certian age groupthe mean score on an achievement test (the mean of a normal population with sigma square (variance)variancesigma square= 256) isless than or equal to 40 against the alternative that it is greater than 40. If the null hypothesisis to be rejected if and only if the mean of the random sample exceeds 43.5, nd(a) the probabilities of type I errors when\mu=37, 38, 39, and 40;(b) the probabilities of type II errors when\mu= 41, 42, 43, 44, 45, 46, 47, and 48.Also plot the power function of this test criterion. What are the two types of anaerobic respiration? Describe the two in one paragraph. ollect "Help Wanted/Jobs/Recruitment advertisement fromthe classified section of your local newspaper.(Note: Weekend editions are usually the most comprehensive.)Find examples of various jobs that are paid by salary, hourly rate,piece rate, and commission. Answer the following for similarjobs.a. How much do they pay?b. What pay periods are used?c. What fringe benefits are being offered? In an oil spill, why does the oil not mix with the seawater? Please include calculation 1. Karya yang dibuat dari susunan potongankain perca disebut karya ....2. Karya montase dibuat dengan teknik ....3. Acuan untuk pembuatan karya disebut ...karya4. Menyiapkan alat dan media merupakan lang-kah ... merancang karya.5. Kertas gambar merupakan ... untuk membuatrancangan karya.Tolojg dijawab dengan benar jangan asal jawab,, bagi bagi poin which of these is not an input device? mouse monitor scanner keyboard In the file MajorSalary, data have been collected from 111 College of Business graduates on their monthly starting salaries. The graduates include students majoring in management, finance, accounting, information systems, and marketing. Create a PivotTable in Excel to display the number of graduates in each major and the average monthly starting salary for students in each major. Which of the following equations has a slope of -2 and passes through the point (3,-4)? Help !!!! Please I need to answer this ASAP in the context of quality control practices in manufacturing, if supplier documentation is done properly, incoming inspection can be completely eliminated. a. true b. false A city doubled its size every 83 years. If the population is currently 88,200 what will the population be in 249 years? Enzymes only work with specific substrates because substrates: If a company uses an actual cost system, inventory records can first be updated from the:____.a. vendor invoice b. purchase order c. receiving report d. purchase requisition What does reproachful mean in English? A facility that manufactures drug substances uses components that must be stored at ambient temperature (18-20oC), at refrigerated temperature (2-8oC), and frozen ( If an unemployed person quits looking for work, then, eventually the unemployment rate a. decreases, and the labor-force participation rate is unaffected. b. and the labor-force participation rate are both unaffected. c. and the labor-force participation rate both decrease. d. is unaffected, and the labor-force participation rate decreases.