For the month of April, a checking account has a balance of $523 for 23 days, $2340 for 4 days, and $238 for 3 days. What is the account's mean daily balance for
April?

The account's mean daily balance for April is approximately $
(Round to two decimal places as needed.)

Answers

Answer 1

Answer:

Approximately $103.37 per day

Step-by-step explanation:

As April has 30 days, we have to add together $523, $2340, and $238 to get the total balance for the entire month. In this case, the total balance is $3101. Now, referring back to April having 30 days, $3101÷30 days=$103.366666666 a day, when rounded to two decimal places, it equals $103.37 a day. So, the account's mean daily balance for April is approximately $103.37 a day.

Hopefully the explanation and the answer helps!

Answer 2

The mean daily balance will be 736.77

What is weighted mean?

Weighted mean is the mean where some of the value contributing more than the other values.

Weighted mean can be calculated by dividing the sum of frequencies and value by the sum of the frequencies.

weighted mean= ∑fₙxₙ/∑fₙ

where f is the frequency and x is the value.

So according to asked question,

in April, balance is in such a way that $523 for 23 days, $2340 for only 4 days, and $238 for only 3 days.

x₁=$523   ,   f₁=23

x₂=$2340   ,   f₂=4

x₃=$238   ,   f₃=3

weighted mean= sum of the product frequency and value/sum of frequency

=  ∑fₙxₙ/∑fₙ

= ((523*23)+(2340*4)+(238*3))/(23+4+3)

=22103/30

=736.7666≅736.77

Therefore the mean daily balance will be $736.77.

Learn more about weighted mean

here: https://brainly.com/question/23902866

#SPJ2


Related Questions

Which of the following does () simplify to, for any nonnegative real number?

Which of the following does () simplify to, for any nonnegative real number?

Answers

Solution

\((\sqrt[]{r})^2\)

We have

square will cancel out the square root

\((\sqrt[]{r})^2=(r)=r\)

Option A

For every 1/150 square mile Xavier mows, 1/20 square mile. How many square mile does Xacier now for every 1 square mile Bao mows

Answers

The 1/3000 square mile does Xacier now for every 1 square mile Bao mows, so we can set up a proportion using the given information.

The amount of area that Xavier mows "X" and the amount of area that Bao mows "B". We know that for every 1/150 square mile that Xavier mows, Bao mows 1/20 square mile. So we can set up the following proportion:

X / (1/150) = B / (1/20)

To solve for X in terms of B, we can cross-multiply and simplify:

X = (1/150) * B * (1/20)

X = B / 3000

This means that for every 1 square mile that Bao mows, Xavier mows 1/3000 square miles. To find the amount of area that Xavier mows for every 1 square mile that Bao mows, we can simply divide X by B:

X / B = (1/3000) / 1

X / B = 1/3000

Therefore, Xavier mows 1/3000 square miles for every 1 square mile that Bao mows.

To know more about square miles, visit:

https://brainly.in/question/16330960

#SPJ11

Please use curve sketching algorithms
11. Given the following analysis of a function, sketch a possible graph for the function. y 10 f(-1)=5 f(5) = 7 lim f(x) = -00 x-3+ lim f(x) = -00 f'(5) = 0 f'(x) 5 -6 f"(-1) = 0 f"(5)

Answers

Based on the given analysis, the possible graph for the function can be sketched as follows:

1. The function has a point at (x=-1, y=5). This indicates that the graph intersects the y-axis at (0, 5).

2. Another point on the graph is (x=5, y=7). This implies that the graph intersects the x-axis at (5, 0).

3. As x approaches negative infinity, the limit of the function goes to negative infinity. This suggests that the graph has a vertical asymptote as x approaches negative infinity.

4. Similarly, as x approaches positive infinity, the limit of the function also goes to negative infinity. This indicates the presence of a vertical asymptote as x approaches positive infinity.

5. The derivative of the function at x=5 is zero (f'(5) = 0). This means that the graph has a horizontal tangent at (5, 7).

6. The slope of the tangent lines to the graph to the left of x=5 is negative (f'(x) < 0). This indicates a decreasing interval to the left of x=5.

7. The concavity of the function at x=-1 is zero (f"(-1) = 0). This implies that the graph changes concavity at (-1, 5).

8. The concavity of the function at x=5 is negative (f"(5) < 0). This indicates a downward concavity at (5, 7).

Based on these observations, the sketch of a possible graph for the function can be represented as follows:

\(\[\begin{tikzpicture}\\\\\draw[- > ] (-4,0) -- (7,0) node[right] {\(x\)};\\\\\draw[- > ] (0,-4) -- (0,8) node[above] {\(y\)};\\\\draw[domain=-3:6,smooth,variable=\x,blue] plot ({\x},{0.3*\x^3-\x^2-3});\\\\\draw[dashed] (5,0) -- (5,7) node[above right] {\((5,7)\)};\\\\\\draw[dashed] (-1,0) -- (-1,5) node[above left] {\((-1,5)\)};\\\\\draw[dashed] (0,5) -- (-1,5);\filldraw[black] (-1,5) circle (1.5pt);\filldraw[black] (5,7) circle (1.5pt);\end{tikzpicture}\]\)

Please note that the sketch is an approximation based on the given analysis, and the actual graph may vary in terms of exact shape and scale.

To know more about Terms visit-

brainly.com/question/30762895

#SPJ11

Tim buys fencing to put around his backyard. The fencing

is sold in 6-ft long panels and costs $55 per panel. He

needs 160 ft of fencing. What is the total cost of the

panels?

Answers

The total cost of the panels bought by Tim for the fencing is $1466.67.

Explain the term unitary method?The unitary approach is a strategy for problem-solving that involves first determining the price of a specific unit, then multiplying that value to determine the required value.

For the given conditions-

Tim purchases fencing for his property.The cost of the fencing is $55 for each 6-foot-long panel.

The can be written as-

6 ft length  -----> $55.

For 1 foot, divide both sides by 6

1 foot ----> $55/6

for 160 ft, multiply both sides by 160

160 ft ---->  $55 x 160 /6

160 ft ---> $1466.67

Thus, the total cost of the panels for the fencing is $1466.67.

To know more about the unitary method, here

https://brainly.com/question/8083231

#SPJ4

Solve the right triangle for all unknown sides and angles. Round your answers to two decimal places.
B = 71
, b = 24

Answers

Angle A is 19 degrees.

Angle C is 90 degrees.

Side a is approximately 7.83.

Side c is approximately 34.50.

To solve the right triangle given that B = 71 degrees and b = 24, we can use the trigonometric ratios sine, cosine, and tangent.

Finding Angle A:

Angle A is the complementary angle to B in a right triangle, so we can calculate it using the equation:

A = 90 - B

Substituting the given value, we have:

A = 90 - 71

A = 19 degrees

Therefore, Angle A is 19 degrees.

Finding Angle C:

Since it is a right triangle, Angle C is always 90 degrees.

Therefore, Angle C is 90 degrees.

Finding Side a:

We can use the sine ratio to find the length of side a:

sin(A) = a / b

Rearranging the equation to solve for a, we have:

a = b * sin(A)

Substituting the given values, we have:

a = 24 * sin(19)

a ≈ 7.83

Therefore, the length of side a is approximately 7.83.

Finding Side c:

Using the Pythagorean theorem, we can find the length of side c:

c^2 = a^2 + b^2

Substituting the given values, we have:

c^2 = 7.83^2 + 24^2

c^2 ≈ 613.68 + 576

c^2 ≈ 1189.68

Taking the square root of both sides to solve for c, we have:

c ≈ √1189.68

c ≈ 34.50

Therefore, the length of side c is approximately 34.50.

To know more about trigonometric ratios, visit

https://brainly.com/question/23130410

#SPJ11

which of the following sets are discrete?!? check all that apply. ​

which of the following sets are discrete?!? check all that apply.

Answers

which of the following sets are discrete?

Answer: C. {2,4,6,8}

Step-by-step explanation:

because constituting a separate entity : individually distinct several discrete sections. 2a : consisting of distinct or unconnected elements : noncontinuous. b : taking on or having a finite or countably infinite number of values discrete probabilities a discrete random variable.

2. Select true or false for each statement about the data above.
A. The most common length of ribbon is 11/
B. The sum of the longest and shortest lengths is 20¹
C. The difference between the longest and shortest
lengths is 2.
X
+
11
-
215
Part Two
A group of children picked oranges and made orange juice. The line plot below shows
the amount of juice each child made. Use the line plot below to answer questions 3-7.
X
x x
X
+
N
X
+
+ +
2²/12 2²/ 2/²/
Quarts of Orange Juice Made
3. What is the greatest amount of juice?
True False
416
True False
True False
XX
+
N
516
4. What is the least amount of juice?
5. What is the sum of the least and greatest amount of juice? Show your work.
X
+
M
6. What is the difference between the greatest and least amount of juice? Show your
work.
7. If the children were to share the juice equally, how much would each child get?
Show your work.

Answers

Graph C shown in the image attached below is a line plot which correctly shows the data.The most common length of ribbon is 11 1/4: True.The sum of the longest and shortest lengths is 20 1/8: False.The difference between the longest and shortest lengths is 2 1/8: False.The greatest amount of juice is equal to 3.The least amount of juice is equal to 1 4/6.The sum of the least and greatest amount of juice is 4 2/3. The difference between the greatest and least amount of juice is 4/3.If the children were to share the juice equally, the amount of juice each would get is 2 27/80.

What is a number line?

A number line can be defined as a type of graph with a graduated straight line which contains both positive and negative numerical values that are placed at equal intervals along its length.

What is a line plot?

A line plot can be defined as a type of graph that is used to graphically represent a data set above a number line, while using crosses, dots, or any other mathematical symbol.

Based on the data provided in the complete question, we can logically deduce the following points:

Length of ribbon (11 1/4) = 3.Length of ribbon (10 3/4) = 1.Length of ribbon (10 1/2) = 1.Length of ribbon (10 7/8) = 1.Length of ribbon (10 5/8) = 1.Length of ribbon (9 7/8) = 1.

In conclusion, graph C shown in the image attached below is a line plot which correctly shows the data from the table above.

The most common length of ribbon is 11 1/4: True.

The sum of the longest and shortest lengths is 20 1/8: False.

Sum = 11 1/4 + 9 7/8

Sum = 21 9/8 ≠ 20 1/8.

The difference between the longest and shortest lengths is 2 1/8: False.

Difference = 11 1/4 - 9 7/8

Difference = 1 3/8 ≠ 2 1/8 .

Part Two.

The greatest amount of juice is equal to 3.

The least amount of juice is equal to 1 4/6.

The sum of the least and greatest amount of juice is:

Sum = 1 4/6 + 3

Sum = 4 4/6 = 4 2/3.

The difference between the greatest and least amount of juice is:

Difference = 3 - 1 4/6

Difference = 8/6 = 4/3.

How much would each child get?

If the children were to share the juice equally, the amount of juice each would get should be calculated by determining the mean:

Mean = [F(x)]/n

Mean = (1 4/6 + 2 + 2 + 2 + 2 2/6 + 2 5/6 + 2 5/6 + 3)/8

Mean = 18.7/8

Mean = 2.3375 = 2 27/80.

Read more on line plot here: https://brainly.com/question/8989301

#SPJ1

Complete Question:

Katie recorded the length, in inches, of the ribbon pieces she was going to use for a project. Use this information for questions 1 and 2.

11 1/4, 11 1/4, 10 3/4, 10 1/2, 10 7/8, 10 5/8, 9 7/8,  11 1/4,

1. Which line plot correctly shows the data?

2. Select true or false for each statement about the data above.A. The most common length of ribbon is
2. Select true or false for each statement about the data above.A. The most common length of ribbon is

It is given that the volume of the cylinder and the cuboid are the same. Find the value of x and give your answer correct to two decimal places. Jawapan / Answer: 7 cm 8 cm [3 markah/ 3 marks] For Examine Use

who can help me pls​

It is given that the volume of the cylinder and the cuboid are the same. Find the value of x and give

Answers

Step-by-step explanation:

the radius of the circular base is 7/2=3.5 cm

the surface of the base is πr^2=π*(3.5)^2=38.465

volume of the cylinder is surface of the base*high

38.465*30=1153.95

the cuboid volume=8^2*x=64x

64x=1153.95

x=1153.95/65=18.03 cm=18 cm

(a) Suppose there are two classes into which we can classify a new value of the item. The probability that a classifier correctly allocates a new object is p = 0.7, and therefore 0.3 is the probability of making an error. To improve the classification accuracy, several independent classifiers may be used to classify the new value.
(i) Suppose there are three classifiers used to allocate a new object. If a majority deci- sion is made, what is the probability that the new object will be correctly classified?
(ii) By increasing the number of classifiers, the classification accuracy can be further improved. Use R to calculate the probabilities of correct classifications when the number of classifiers are 3,5,7,..., 29 (odd numbers from 3 to 29). Graph these probabilities.

Answers

(i)  When using three classifiers with a majority decision, the probability of correctly classifying the new object is 0.973.

(ii) The probability of correct classification increases as the number of classifiers increases

How to calculate the probability

(i) All three classifiers make the correct classification: p * p * p = 0.7 * 0.7 * 0.7 = 0.343.

Two classifiers make the correct classification and one classifier makes an error:

(p * p * q) + (p * q * p) + (q * p * p) = 3 * (0.7 * 0.7 * 0.3) = 0.441.

One classifier makes the correct classification and two classifiers make errors:

(p * q * q) + (q * p * q) + (q * q * p) = 3 * (0.7 * 0.3 * 0.3)

= 0.189.

The probability of the new object being correctly classified is the sum of these probabilities:

0.343 + 0.441 + 0.189

= 0.973.

(ii)  The probability of correct classification increases as the number of classifiers increases. This is because the probability of a majority decision being correct is the probability that at least two of the classifiers make the correct decision. The more classifiers there are, the more likely it is that at least two of them will make the correct decision.

Learn more about probability on

https://brainly.com/question/24756209

#SPJ4

Is 6 a factor of 20 yes or no

Answers

Answer:

no 6 aint no factor of 20

Step-by-step explanation:

Determine whether the Mean Value Theorem can be applied to f on the closed interval [a,b]. (Select all that apply.) f(x)= x−10
x

,[1,9] Yes, the Mean Value Theorem can be applied. No, f is not continuous on [a,b]. No, f is not differentiable on (a,b). None of the above. c=

Answers

Yes, the Mean Value Theorem can be applied to f on the closed interval [1,9]. To determine if the Mean Value Theorem can be applied to the function f(x) = (x - 10)/x on the closed interval [a, b] = [1, 9], we need to check if the function is continuous on the interval and differentiable on the open interval (a, b) = (1, 9).

1. Continuity: The function f(x) = (x - 10)/x is continuous for all x ≠ 0. Since the interval [1, 9] does not include x = 0, the function is continuous on this interval.

2. Differentiability: To check differentiability, we need to find the derivative of f(x). The derivative of f(x) = (x - 10)/x can be found using the Quotient Rule:

f'(x) = [(1)(x) - (x - 10)(1)]/(x^2) = [x - (x - 10)]/(x^2) = 10/x^2

Since the derivative exists for all x ≠ 0 and the interval (1, 9) does not include x = 0, the function is differentiable on this open interval.

Therefore, the Mean Value Theorem can be applied to the function f(x) = (x - 10)/x on the closed interval [1, 9].

Your answer: Yes, the Mean Value Theorem can be applied.

Learn more about Mean here:- brainly.com/question/31101410.

#SPJ11

Find a quadratic function with vertex (3 -4) and passes through
the point (0,4).

Answers

f(x) = (8/9)(x-3)² - 4 which has a vertex at (3,-4) and passes through the point (0,4).

What is a quadratic equation?

A quadratic equation is a second-degree polynomial equation of the form:

ax² + bx + c = 0

where a, b, and c are constants, and x is the variable. Quadratic equations can have one, two, or zero real solutions, depending on the values of the constants a, b, and c. The solutions can be found using the quadratic formula:

x = (-b ± \(\sqrt{b^2 - 4ac}\)) / 2a or by factoring the quadratic expression into two linear factors.

A quadratic function can be expressed in the form:

\($$f(x) = a(x-h)^2 + k$$\)

where (h,k) is the vertex of the parabola.

From the problem, we have the vertex (h,k) = (3,-4). Substituting these values into the equation gives:

\($$f(x) = a(x-3)^2 - 4$$\)

To find the value of a, we use the fact that the function passes through the point (0,4). Substituting x=0 and y=4 into the equation gives:

\($$4 = a(0-3)^2 - 4$$\)

Simplifying and solving for a, we get:

a=8/9

Therefore, the quadratic function is:

f(x) = (8/9)(x-3)² - 4

which has a vertex at (3,-4) and passes through the point (0,4).

To know more about quadratic equations  visit:

brainly.com/question/30098550

#SPJ1

Write the numbers in order from greatest to least.

0.115, 0.15, 0.005, 0.5

Answers

Answer:

0.5, 0.15, 0.115, 0.005

Step-by-step explanation:

A number can be written from the greatest to the and the lowest to the highest when given a series of number. This series of number can be in mixed fraction forms, improper fraction or decimal. When a number is said to be written from the greatest to the lowest, it is called descending order but from the lowest to the greatest it is called ascending order.

From the list of the series of the decimal numbers given, writing the numbers in order from the greatest to the least number will choose the form:

0.5, 0.15, 0.115, 0.005

Can someone pls help me!

Can someone pls help me!

Answers

Answer:

x is -3

Step-by-step explanation:

Can someone help me with this please? I'll give you brainliest! :)

Can someone help me with this please? I'll give you brainliest! :)

Answers

Fxn or nfx and for the symbol I can’t see the options

\({ \qquad\qquad\huge\underline{{\sf Answer}}} \)

Here we go ~

The given figure is of a " Line segment " it can simply be represented by The endpoints written in any order with a bar on it.

And for the given line segment, we can name it in two different ways that are :

\(\qquad \sf  \dashrightarrow \: \overline{NX }\)

and

\(\qquad \sf  \dashrightarrow \: \overline{XN }\)

A menu has:
5 starters
8 main dishes
4 desserts

a) A three-course meal consists of a starter, a main dish and a dessert. How many different three-course meals are possible?
b) A two-course meal consists either of a starter with a main dish, a starter with a dessert, or a main dish with a dessert. How many different two-course meals are possible?​

Answers

Answer:

1 A 4 three-course meal can be possible

2 An 8 two course meal can be available

Step-by-step explanation:

This is because the number of dessert is the lowest which is and the starter and main dishes are higher in number since only 4 desert can go around only a 4 three course meal is available.

2 This is because 5+8+4= 17. Since it's a two course meal 17÷2= 8.5. Meaning 8 meals are the only whole 2 course meal available

Final answer:

By applying the counting principle in combinatorics, we find that there are 160 different possible three-course meals and 92 different possible two-course meals in the given menu.

Explanation:

This question involves the concept of the counting principle, a fundamental principle in combinatorics. The principle states that if there are m ways to do one thing, and n ways to do another, then there are m*n ways of doing both.

In part a), a three-course meal consists of one starter, one main dish, and one dessert. To figure out the number of different meals possible, we multiply the number of options at each course: 5 starters * 8 main dishes * 4 desserts, which equals 160 different three-course meals.

In part b), a two-course meal consists of either a starter with a main dish, a starter with a dessert, or a main dish with a dessert. For each of these combinations, we multiply the number of possibilities at each course and then add the results together. Hence, (5 starters * 8 main dishes) + (5 starters * 4 desserts) + (8 main dishes * 4 desserts) equals 40 + 20 + 32, giving us 92 different two-course meals.

Learn more about Counting Principle here:

https://brainly.com/question/33601419

#SPJ2

3) Kelsey takes out a loan for $6000 to start a business after high school. The bank
charges her 8% interest for the loan. After 5 years how much interest will be added
on to the loan?

Answers

Answer:

$2400

Step-by-step explanation:

SIMPLE INTEREST = (P × T × R)/100

= (6000 × 5 × 8)/100

= 2400

1.)34°C=__°F
2.)94.6°F=__°C
3.)80°F=__°C
4.)42°C=__°F
5.)18°C=__°F​

Answers

Answer:

Answer:

Step-by-step explanation:

1.)93.2F

2.)34.78°C

3.)26.67°C

4.)107.6°F

5.)64.4°F

I hope it's helpful!

8.7x minus 1.9x = 116.96

Answers

Answer:

17.2

Step-by-step explanation:

Let's solve your equation step-by-step.

8.7x−1.9x=116.96

Step 1: Simplify both sides of the equation.

8.7x−1.9x=116.96

8.7x +−1.9x=116.96

(8.7x +-1.9x)=116.96 (Combine Like Terms)

6.8x=116.96

6.8x=116.96

Step 2: Divide both sides by 6.8.

6.8x ÷ 6.8 = 116.96 ÷ 6.8

x=17.2

Answer:

x=17.2

what is difference between 10 and 12?

Answers

Answer:

2 units

Step-by-step explanation:

To find the difference between 10 and 12, we can use this equation:

12 - 10 = 2

Or:

10 - 12 = -2

Therefore, the difference is 2.

Write the expression in descending order of y: y^3-y+6-7y^2​

Answers

Answer:

Step-by-step explanation:

Write the expression in descending order of y: y^3-y+6-7y^2

Sam and Adam share a sum of money in the ratio 7:9 What fraction of the money does Sam receive?

Answers

The fraction of the money that Sam receives is \(\frac{7}{16}\) of the money they share.

To solve this problem, we need to first understand what the ratio 7:9 means. It means that for every 7 parts that Sam receives, Adam receives 9 parts.
Let's say the sum of money they are sharing is $100. To find out how much Sam receives, we need to divide the total amount into 16 parts (7 + 9).
Each part would then be worth $6.25 ($100 ÷ 16).
To find out how much Sam receives, we need to multiply the number of parts he receives by the value of each part.
Sam receives 7 parts out of 16, so his share would be 7 x $6.25 = $43.75.
To express this as a fraction, we can put Sam's share over the total amount:
\(\frac{43.75}{100}\)
We can simplify this fraction by dividing both the numerator and denominator by 25:
\(\frac{1.75}{4}\)
Therefore, the fraction of the money that Sam receives is \(\frac{1.75}{4}\) or \(\frac{7}{16}\).
In summary, Sam receives \(\frac{7}{16}\) of the money they share, which is equivalent to $43.75 if the total amount they are sharing is $100.

Learn more about ratio here:

https://brainly.com/question/31945112

#SPJ11

G
A scale drawing is made to enlarge a picture by using a scale factor of 3. The enlarged picture is 9 inches by 15 inches
What are the dimensions of the original picture?
x
O 3 inches by 5 inches
O 3 inches by 15 inches
O 6 inches by 12 inches
O 27 inches by 45 inches

Answers

Answer:

3 inches by 5 inches

Step-by-step explanation:

You have to divide the numbers 9 and 15 by 3

9÷3=3

15÷3=5

So that means it is 3 inches by 5 inches

Answer:

3 inches by 5 inches

Step-by-step explanation:

You have to divide the numbers 9 and 15 by 3

9÷3=3

15÷3=5

So that means it is 3 inches by 5 inches

Find the volume of the solid that lies within both the cylinder x^2+y^2=1 and the sphere x^2+Y^2+z^2=4

Answers

the volume of the solid within both the cylinder and sphere is (8/3)π.

The given cylinder and sphere intersect at a circle on the xy-plane with radius 1. To find the volume of the solid within both shapes, we can use cylindrical coordinates.
First, we set up the limits of integration: z goes from -sqrt(4-x^2-y^2) to sqrt(4-x^2-y^2), r goes from 0 to 1, and theta goes from 0 to 2pi.
The volume integral can then be set up as:
∫(from 0 to 2pi) ∫(from 0 to 1) ∫(from -sqrt(4-x^2-y^2) to sqrt(4-x^2-y^2)) dz r dr dθ
Simplifying this integral, we get:
V = 2π ∫(from 0 to 1) (4-x^2-y^2)^(1/2) r dr
Solving this integral, we get:
V = (8/3)π.
Therefore, the volume of the solid within both the cylinder and sphere is (8/3)π.

To know more about sphere visit:

https://brainly.com/question/22849345

#SPJ11

a college food court surveyed students to see how many drink tea and how many drink soda. the venn diagram below shows the results. (each number gives the number of students who fall into that venn diagram category.) (a) how many of the students drink soda? (b) how many of the students drink tea or soda (or both)? (c) how many of the students do not drink both tea and soda?

Answers

A college food court surveyed students to see how many drink tea and how many drink soda using the Venn Diagram:

Number of student who drink soda is 197students who drink tea or soda or both 348students do not drink both tea and soda is 88.

In order to solve problems based on these sets, we may use a Venn diagram to depict the logical link between sets and their components. Although other closed figures like squares may be used, a Venn diagram commonly utilises intersecting and non-intersecting circles to indicate the relationship between sets.

A college food court surveyed 407 students to see how many drink tea and how many drink soda.

a.) The number of students who do not drink tea is

197 + 59 = 256

b.) The number of students who drink tea or soda or both is

88 + 63 + 197 = 348

c.) The number of students who drink tea but do not drink soda is 88.

Learn more about Venn Diagram:

https://brainly.com/question/24713052

#SPJ4

Complete question:

A college food court surveyed 407 students to see how many drink tea and how many drink soda. The Venn diagram below shows the results. (Each number gives the number of students who fall into that Venn diagram category.) -All students in the survey Drink tea Drink soda 88 63 197

(a) How many of the students drink soda ?

(b) How many of the students drink tea or soda (or both)? IS students

(c) How many of the students drink tea but do not drink soda?

a college food court surveyed students to see how many drink tea and how many drink soda. the venn diagram

Do you exercise regularly?
how do i put this in a biased questions

Answers

Answer: Did you know that you should exercise regularly?

Step-by-step explanation:

Help me with this problem please it’s due today

Help me with this problem please its due today

Answers

Answer:

1/3

Step-by-step explanation:

please show your work. and I need it done today please.

please show your work. and I need it done today please.

Answers

Answer:

1. t = -1

2. t = -24

3. t = -3

4. t = -2

5. t = -10

Step-by-step explanation:

please show your work. and I need it done today please.
please show your work. and I need it done today please.
please show your work. and I need it done today please.
please show your work. and I need it done today please.
please show your work. and I need it done today please.

10.4 For the following situation. fal determine which evatuation nethod is probably the cusiese and lasitest (o apply hy hand and hy eomputer in order 10 selece from the five allematives, and (h) thst

Answers

Based on the provided question, it seems like you are asking about the most efficient evaluation method, either by hand or using a computer. To determine which method is the most suitable, you need to consider the complexity of the evaluation process and the number of alternatives.


Using a computer is generally faster and more accurate when dealing with large datasets or complex calculations. On the other hand, evaluating by hand may be more suitable for smaller datasets or simpler calculations. It can provide a more hands-on approach, allowing for a deeper understanding of the evaluation process. However, this method is generally more time-consuming and prone to human error.

To select the most appropriate evaluation method, consider the complexity of the task and the available resources. If the evaluation involves a large amount of data or complex calculations, using a computer would likely be the most efficient choice. However, if the task is relatively simple or involves a smaller dataset, evaluating by hand may suffice. In conclusion, the choice between evaluating by hand or using a computer depends on the complexity of the task and the available resources. Consider these factors to determine the most suitable method.

To know more about determine visit:

https://brainly.com/question/29898039

#SPJ11

Write the equation of the line that is perpendicular to the line given and through the given point. Do not use spaces in your equation. y=-x-3 (-1, 4) *

Answers

Answer:

  y=x+5

Step-by-step explanation:

The equation is given in slope-intercept form, so we can read the slope from the equation. It is the x-coefficient, -1.

The slope of the perpendicular line will be the opposite reciprocal of this value:

  -1/-1 = 1

The new y-intercept will be ...

  b = y -mx = (4) -(1)(-1) = 5

Then the slope-intercept equation of the perpendicular line is ...

  y = x +5

Write the equation of the line that is perpendicular to the line given and through the given point. Do
Other Questions
50 points! Mhanifa please help I will mark brainliest. RANDOM ANSWERS WILL BE REPORTED :) What location is the site of an active amethyst mine? rob drove to the nearest hospital with an average speed of v meters per seconds in t seconds. in terms of t, if he drives home on the same path, but with an average speed of 3v meters/second, how long is the return trip home? the incubation time for rhode island red chicks is normally distributed (bell-shaped) with mean 21 days and standard deviation approximately 2 days. use the empirical rule and the normal graph above to answer the following questions. a. 95 % of the rhode island chicks incubation time is between 19 and 23 days. b. % of the rhode island chicks incubation time is in the interval of (23 , 25) days. c. 50% of the rhode island chicks incubation time is is less than days. d. 34% of the rhode island chicks incubation time is between 21 days and e. % of the rhode island chicks incubation time is more than 19 days. Bearer bonds are bonds Multiple Choice with coupons attached that are redeemable by whoever has the bond. where the registered owner automatically receives bond payments when scheduled. in which the issue matures on a series of dates. issued in another currency other than the bond issuer's home currency. issued in a different country other than the bond issuer's home country. True or false: The invention of the printing press that permitted music to be published and distributed,happened during the Romantic Music Period. due partly to intense competition of our times, a number of retailers (e.g., drugstores) offer several unrelated product lines in a single store. this retail strategy is known as __________. What is the net electric field midway between two equal positive charges q1 = + 4.0 C, placed at x = + 1.0 m, and q2 +4.0 C, placed at x =-1.0 m? A. 72,000 N/C to the right B. 9000 N/C to the left C. 0 V D. 36,000 N/C to the left X- If 25* = 36, what does 5* equal? 5* = |(Simplify your answer. Type an integer or a fraction.) %3D Solve the equation. log 6216^ = -3 The solution set is (Type an integer or a simplified fraction. Use a comma to separate answers as needed.) will give away lots of points! 25 total!!!! x delivery persons carry a total of B bags of groceries up the stairs. They can each carry y bags at a time, and they each make 2 trips up the stairs.Write an equation that relates x, B, and y. What do you wonder about related to space orNASA? (at least 3)Hurry a fully amortizing mortgage is made for $118,000 at 6.5 percent interest. required: if the monthly payments are $1,090 per month, when will the loan be repaid?\ nigerian ivory mask from the mid-fifteenth century refers to contact with the portuguese by representing a brass plaque a sword. a decorative design with mudfish. a decorate pattern of intertwined muskets. A school in new zeland collected data about the employment status of the mother and father in two parent-families. The two-way table of column relative frequencies below shows the data a modified roulette wheel has 36 slots. one slot is 0, another is 00, and the others are numbered 1 through 34, respectively. you are placing a bet that the outcome is an odd number. (in roulette, 0 and 00 are neither odd or even. If one parent have two dominant gene and two recessive gene, what percentage of children will exhibit the dominant gene? What is the meaning of this quote If liberty means anything at all, it means the right to tell people what they do not want to hear. by George Orwell Using the given DNA segment, design 18-22 bases primers to amplify this whole DNA fragment. Be sure you give the primers sequence in 5'>3. DNA segment: 5' GGTTTCTTCCTACCTCAAGAAGGTAGGATACAACCCTGACAAGATCCCCTTTGTCCC CATCTCTGGTTT 3' A Suppose systolic blood pressure of 18-year-old females is approximately normally distributed with a mean of 115 mmHg and a variance of 430.56 mmHg. If a random sample of 20 girls were selected from the population, find the following probabilities:a) The mean systolic blood pressure will be below 116 mmHg.probability =b) The mean systolic blood pressure will be above 123 mmHg.probability =c) The mean systolic blood pressure will be between 109 and 124 mmHg.probability =d) The mean systolic blood pressure will be between 102 and 111 mmHg.probability =Note: Do NOT input probability responses as percentages; e.g., do NOT input 0.9194 as 91.94