Find the general solution of the system whose augmented matrix is given below.
1−3 0 |−5
−3 7 0| 9

Answers

Answer 1

The general solution of the system is (x,y) = (5/3, 4/10).

How to determine general solutions

The given augmented matrix corresponds to the system of equations

1x - 3y = -5

-3x + 7y = 9

To find the general solution of the system, we need to solve for x and y.

To solve for x, add 3 times the first equation to the second equation. This gives us 10y = 4. Therefore, y = 4/10. Substituting this value of y in the first equation, we get x = 5/3.

Therefore, the general solution of the system is (x,y) = (5/3, 4/10).

Learn more about system of equation at

https://brainly.com/question/12895249

#SPJ11


Related Questions

I manage to run a mile in 6 minutes. What is my average speed in miles per hour.












Answers

Answer:

10 miles per hour

Step-by-step explanation:

If you run a mile in 6 minutes...

10miles x 6minutes is 60 minutes. An hour.

You can run 10 miles in the hour at that rate. Does that make sense?

1/6/60=1x60/6=10mile/hour

Which function represents the graph below?​

Which function represents the graph below?

Answers

the second option because the open circles best correlate with that answer

Fill in the blank to create a true equation:

-27 + _ = 0

7 + _ = 0

-3 + _ = +1

-7 + _ = -1

Answers

Answer:

27

-7

4

6

Step-by-step explanation:

Mental math.........

Answer: I do not know

Step-by-step explanation:

I dropped out of 2nd grade

Josh is 6 years older than 5 times Kim's age. The sum of their ages is less than 54.
What is the oldest Kim could be? Show all your work.
I

Answers

Answer:

8

Step-by-step explanation:

Josh is 6 years older than 5 times Kim's age. The sum of their ages is less than 54. What is the oldest Kim could be?

J + k < 54 when  J = 5k + 6 so:

5k + 6  + k < 54

6k + 6 < 54

subtract 6 from both sides:

6k + 6 - 6 < 54 - 6

6k < 48

divide both sides by 6:

6k/6 < 48/6

k < 8

Kim could be 8 at maximum.

supposed that x1 and x2 have the bivariate normal distribution with means mu1 and mu2, and variances s1 and s2 and correlation rho. find the distribution of x1 - 3x2

Answers

The distribution of X₁ - 3X₂ is a normal distribution with mean μ₁ - 3μ₂ and variance s₁² + 9s²₂ - 6rhos₁s₂.

To find the distribution of X₁ - 3X₂, we need to find the mean and variance of this new variable.

The mean of X₁ - 3X₂ is:

E(X₁- 3X₂) = E(X₁) - 3E(X₂) = μ₁ - 3μ₂

The variance of X₁ - 3X₂ is:

Var(X₁ - 3X₂) = Var(X₁) + 9Var(X₂) - 6Cov(X₁,X₂)

Since X₁ and X₂ have a bivariate normal distribution with means μ₁ and μ₂, variances s₁ and s₂ and correlation rho, we know that:

Var(X₁) = s²₁

Var(X₂) = s²₂

Cov(X₁,X₂) = rhos₁ s₂

Substituting these values into the variance equation, we get:

Var(X₁ - 3X₂) = s₁² + 9s²₂ - 6rhos₁s₂.

To learn more about the distributions;

https://brainly.com/question/29062095

#SPJ1

prime factorisation of 28 and 35​

Answers

GCF of 28 and 35 is 7.

Answer:

Prime factorization of 28 and 35 is (2 × 2 × 7) and (5 × 7) respectively. As visible, 28 and 35 have only one common prime factor i.e. 7.

-4(v + 1) + 6v = 2(v + 2) - 8

Answers

Answer:

0 , All real numbers are solutions.

Step-by-step explanation:

Let's solve your equation step-by-step.

−4(v+1)+6v=2(v+2)−8

Step 1: Simplify both sides of the equation.

−4(v+1)+6v=2(v+2)−8

(−4)(v)+(−4)(1)+6v=(2)(v)+(2)(2)+−8(Distribute)

−4v+−4+6v=2v+4+−8

(−4v+6v)+(−4)=(2v)+(4+−8)(Combine Like Terms)

2v+−4=2v+−4

2v−4=2v−4

Step 2: Subtract 2v from both sides.

2v−4−2v=2v−4−2v

−4=−4

Step 3: Add 4 to both sides.

−4+4=−4+4

0=0

Answer:

no solution

Step-by-step explanation:

-4(v + 1) + 6v = 2(v + 2) - 8

-4v - 4 + 6v = 2v + 4 - 8

2v - 4 = 2v - 4

0 = 0

no solution

Maria will spin the arrow on the spinner 2 times. What is the probability that the arrow will stop on the same letter twice?.

Answers

Probability that the arrow will stop on the same letter twice = 1/3 (c).

What is probability?

The area of arithmetic called likelihood deals with numerical representations of the chance that a happening can occur or that an announcement is true.

Main body:

Given : Maria will spin the arrow on the spinner 2 times.

To find : What is the probability that the arrow will stop on the same letter twice.

Solution : We have given a spinner that spin twice and stop on the same letter.

Formula for probability = no. of favourable outcome/ total outcomes

Here, total part of spinner = 3 and it spin two times

So, total possible outcome = 6.  Arrow stay on same letter twice( favorable outcome) =2.

Plugging the values in formula :

Probability =  2/6

Probability =  1/3

Therefore,  probability that the arrow will stop on the same letter twice =  (c).

To know more about probability click on the link below

https://brainly.com/question/24756209

#SPJ4

You buy a car for $22,000 and every year your car depreciates by 14% (in other words, you car decreases in value by 14% every year). What is your car worth in 4 years?

(Create an exponential function to solve this problem.)

Question options:

$18,920


$37,157


$12,034


$25,080

Answers

$12034 is the worth of the car after 4 years.

What is Percentage?

Percentage, a relative value indicating hundredth parts of any quantity.

Given that we purchased a  car for $22,000

Every year your car depreciates by 14%

We have to find the worth of the car after 4 years.

\(A=P(1-r)^{t}\)

P is the principal amount=$12000

r is rate of interest =14%=0.14

t is time =4 years

A=22000(1-0.14)⁴

A=22000(0.86)⁴

A=22000×0.547

A=$12034

Hence, $12034 is the worth of the car after 4 years.

To learn more on Percentage click:

https://brainly.com/question/28269290

#SPJ1

John is looking at the eagle on top of a building The height of the building is 120 ft Approximately how many feet is Jack away from the base of the building?

Answers

Answer:

The answer is below

Step-by-step explanation:

The question is not complete. A similar question is attached and is solved.

Solution:

A triangle is a polygon with three sides and three angles. Types of triangles are scalene, acute, obtuse, isosceles, equilateral and right angled triangle.

A right angled triangle is a triangle with one angle equal to 90 degrees. The longest side of a right angled triangle is known as the hypotenuse. Trigonometric identities is used to show the relationship between the angles and sides of a right angled triangle, i.e.:

sinθ = opposite/hypotenuse; cosθ = adjacent / hypotenuse; tanθ = opposite / adjacent

From the image:

let the distance from jack to the base of the building be x, hence:

tan60 = x / 60

x = 60 * tan60 = 104 ft.

John is looking at the eagle on top of a building The height of the building is 120 ft Approximately

Use the information to answer the question.
A crew is loading crates onto a train. They can load 4 crates every 1.25 minutes. Each crate weighs 160 pounds.
C
=
At that rate, how many minutes would it take the crew to load crates with a total weight of 2400 pounds? Round the answer to the nearest
tenth. Enter the answer in the box.
minutes
Plz help me no links

Use the information to answer the question.A crew is loading crates onto a train. They can load 4 crates

Answers

Answer:

4.7

Step-by-step explanation:

2400/160 =15 crates

4/1.25=3.2 crates a minute

15/3.2=4.68 minutes

4.7 because it rounds up

To load 2400 pounds of crates crew will take around 4.69 minutes.

What are the ratio and proportion?

The ratio is the division of the two numbers.

For example, a/b, where a will be the numerator and b will be the denominator.

Proportion is the relation of a variable with another. It could be direct or inverse.

Given,

Crew can load 4 crates every 1.25 minutes

4 creates ⇔ 1.25 minutes

Given,

1 crate = 160 pounds

So,

4 crate = 640 pounds

So,

640 pounds ⇔ 1.25 minutes

1 pound ⇔ 1.25/640 minutes

To load 2400 pounds

2400 pounds ⇔(1.25/640)2400 minutes

2400 pounds ⇔ 4.6875 minutes.

Hence " To load 2400 pounds of crates crew will take around 4.69 minutes".

For more information about ratio and proportion,

brainly.com/question/26974513

#SPJ5

ILL GIVE BRAINIEST TO PERSON WHO ANSWERS CORRECTLY

ILL GIVE BRAINIEST TO PERSON WHO ANSWERS CORRECTLY

Answers

Observe the graph .

There is a coordinate lies on y axis It's (0,3)

Y intercept=3

More:-

Slope intercept form

y=mx+b

Where

m=slopeb=y intercept

the primary reason that the standard deviation is preferred to the variance is because: group of answer choices the standard deviation is easier to calculate than the variance. the standard deviation returns the data to its original unit of measurement. the standard deviation is the most widely used measure of center. the standard deviation is expressed as a percent rather than a whole number.

Answers

The primary reason that the standard deviation is preferred to the variance is because the standard deviation is the most widely used measure of center.

Standard deviation and variance are two fundamental mathematical concepts that play an important role in everything from accounting to economics to investing in finance. Both use the average of a set of numbers to measure the variability of numbers in a data set. They are important to help determine volatility and return distributions. But there are inherent differences between the two. The standard deviation measures the square root of the variance, which is the average of each point from the mean.

(1) Standard deviation measures the distance between numbers in a set of data. The variance, on the other hand, gives the true value of the difference between the numbers in the data set and the mean.

(2) The standard deviation is the square root of the variance, expressed in the same units as the data set. Variance can be expressed as a square unit or as a percentage (especially in financial terms).

(3) The standard deviation can be greater than the variance because when the variance is less than one (1.0 or 100%).

(4) When the deviation is greater than 1 (such as 1, 2, or 120%), the standard deviation is less than the deviation.

Learn more about Standard Deviation:

https://brainly.com/question/23907081

#SPJ4

If y = 2 while x = -6, find x when y = -3. (y varies inversely with x.)

Answers

Answer:

Step-by-step explanation:

Inverse variation satisfies the form yx=k, if y=2 while x=-6 then

2(-6)=k, k=-12, then

yx=-12, when y=-3

-3x=-12

x=4

Person above has the right answer

class 10question - If the sum of 5 numbers is 175 and the product of second and third term is 1125. find the answer


pls give it fast will mark brainliest

Answers

If the sum of 5 numbers is 175 and the product of second and third term is 1125, and then the five numbers are 20, 45, 25, 30, and 55.

Let's solve the problem step by step.

Let the five numbers be a, b, c, d, and e.

According to the given information, we have two equations:

a + b + c + d + e = 175 (Equation 1)

b * c = 1125 (Equation 2)

We need to find the values of a, b, c, d, and e that satisfy both equations.

From Equation 2, we know that b * c = 1125. To find the values of b and c, we need to find the factors of 1125.

The factors of 1125 are: 1, 3, 5, 9, 15, 25, 45, 75, 125, 225, 375, 1125.

Since the product of b and c is 1125, we can assign b = 45 and c = 25.

Substituting the values of b and c into Equation 1, we have:

a + 45 + 25 + d + e = 175

a + d + e = 175 - 45 - 25

a + d + e = 105 (Equation 3)

Now we have two equations:

a + d + e = 105 (Equation 3)

b * c = 1125 (Equation 2)

We need to find the values of a, b, c, d, and e that satisfy both equations.

We can choose any values for a, d, and e as long as their sum is 105. For example, let's assign a = 20, d = 30, and e = 55.

Substituting these values into Equation 3, we have:

20 + 30 + 55 = 105

Therefore, the five numbers are a = 20, b = 45, c = 25, d = 30, and e = 55.

Know more about Product here:

https://brainly.com/question/30284183

#SPJ8

Linear equations- please help me
−5(5x+3)−5x+1=−44

Answers

the answer is x=1
Add the numbers
Combine like terms
Add
to both sides of the equation

Simplify

Divide both sides of the equation by the same term

A store has a sell. You can purchase 3 cds for 45$. Which ratio describes the unit rate

Answers

Answer:

$15 for 1 CD or 15:1

Step-by-step explanation:

You just divide 45 by 3 and get your answer for value per CD. :)

What is the equation for -15x=90

Answers

Answer:

x=-6

Step-by-step explanation:

x=-6

The answer is:

x = -6

Work/explanation:

We're asked to solve the equation \(\boldsymbol{ -15x = 90}\).

This is a one step equation. So we should be able to solve it in just one step.

To solve this equation, divide each side by -15:

\(\sf{-15x=90}\)

\(\sf{x=-6}\)

Therefore, x = -6.

i’ll give brainliest help

Find the indicated side of the
triangle.
a
30°
b
b = [?][]

ill give brainliest helpFind the indicated side of thetriangle.a30bb = [?][]

Answers

Answer:

For a:

sin-theta=p/h

sin30= 7/h

hsin30=7

h=7/sin30

h or a=14

For b:

cos-theta=b/h

cos30= b/14

b=14cos30

b= 12.12

Here is your answer : )
ill give brainliest helpFind the indicated side of thetriangle.a30bb = [?][]

Last month, ed spent $50 in all. He spent 40% of the money at the movies. How much money did ed spend at the movies?.

Answers

Last month, ed spent $50 in all. He spent 40% of the money at the movies. So $20 Ed spend at the movies.

In the given question we have to find how much money ed spend at the movie.

Last month Ed spend total $50.

He spent 40% of the money at the movie.

Total money spent by Ed last month = $ 50.

Percentage of the money spent at the movies = 40%

Money spend by Ed at the movies=Percentage of the money spent at the movies * Total money spent by Ed last month

Money spend by Ed at the movies= 40% * $50

Money spend by Ed at the movies= 40/100 * $50

Money spend by Ed at the movies= 0.4* $50

Money spend by Ed at the movies= $20

To learn more about percentage link is here

brainly.com/question/16797504

#SPJ4

The table shows how much kim earned from 1996 to through 2004. What is the equation fora trend line that models an approximate relationship between time and kims annual salary? Let 1996 = 0

Answers

The equation for the trend line that models the relationship between time and Kim's annual salary is Y = 2250x + 42,000.

To find the equation for the trend line, we need to determine the relationship between time (years) and Kim's annual salary. We can use the given data points to calculate the slope and intercept of the line.

Using the points (0, 42,000) and (8, 60,000), we can calculate the slope as (60,000 - 42,000) / (8 - 0) = 2250. This represents the change in salary per year.

Next, we can use the slope and one of the points to calculate the intercept. Using the point (0, 42,000), we can substitute the values into the slope-intercept form of a line (y = mx + b) and solve for b.

Thus, the equation for the trend line that models the relationship between time and Kim's annual salary is Y = 2250x + 42,000, where x represents the number of years since 1996 and Y represents the annual salary.

Learn more about trend line here:

https://brainly.com/question/29249936

#SPJ11

A 8.50 kg object has the given x and y acceleration components. aₓ = (0.43 m/s²) + (0.79 m/s³) t
aᵧ = (11.9 m/s²) - (0.63 m/s³) t What is the magnitude Fₙₑₜ of the net force acting on the object at time = 6.87 s? Fₙₑₜ = 81.37
What is the angle θ of the net force at this same time? Give your answer as a number of degrees counter-clockwise from the +x-axis.
θ = .......
Incorrect

Answers

To find the angle θ of the net force at time t = 6.87 s, we need to first find the x and y components of the net force, and then use the inverse tangent function to find the angle.

The x component of the net force is given by:

Fₙₑₜ,ₓ = m aₓ = (8.50 kg)(0.43 m/s² + 0.79 m/s³(6.87 s)) = 3.63 N

The y component of the net force is given by:

Fₙₑₜ,ᵧ = m aᵧ = (8.50 kg)(11.9 m/s² - 0.63 m/s³(6.87 s)) = 92.52 N

The magnitude of the net force is given by:

|Fₙₑₜ| = sqrt(Fₙₑₜ,ₓ² + Fₙₑₜ,ᵧ²) = sqrt(3.63² + 92.52²) = 92.67 N

The angle θ of the net force is given by:

θ = tan⁻¹(Fₙₑₜ,ᵧ / Fₙₑₜ,ₓ) = tan⁻¹(92.52 N / 3.63 N) = 86.5°Therefore, the angle θ of the net force at time t = 6.87 s is approximately 86.5° counter-clockwise from the +x-axis.

#SPJ1

Plzz help will mark brainiest Don't do it for the points

Plzz help will mark brainiest Don't do it for the points

Answers

Answer:

I think the answer is B

Step-by-step explanation:

Question 2 of 6 View Policies Current Attempt in Progress Express the following as a linear combination of u =(3, 1,6), v = (1.-1.4) and w=(8,3,8). (14, 9, 14) = ____ u- _____ v+ _____

Answers

Answer: The given vector can be expressed as a linear combination of u, v, and w as (14, 9, 14) = u - v + 3w.

Question: Express the following as a linear combination of u =(3, 1,6), v = (1.-1.4) and w=(8,3,8). (14, 9, 14) = ____ u- _____ v+ _____

Current Progress: To express the given vector as a linear combination of u, v, and w, we need to find scalars a, b, and c such that (14, 9, 14) = a*u + b*v + c*w.

Step 1: Write the equation in component form:
(14, 9, 14) = (3a + b + 8c, a - b + 3c, 6a + 4b + 8c)

Step 2: Equate the corresponding components and solve for a, b, and c:
3a + b + 8c = 14
a - b + 3c = 9
6a + 4b + 8c = 14

Step 3: Solve the system of equations using any method (substitution, elimination, etc.). One possible solution is a = 1, b = -1, and c = 3.

Step 4: Plug the values of a, b, and c back into the linear combination equation:
(14, 9, 14) = 1*u + (-1)*v + 3*w

Step 5: Simplify the equation:
(14, 9, 14) = u - v + 3w

Answer: The given vector can be expressed as a linear combination of u, v, and w as (14, 9, 14) = u - v + 3w.

Learn more about Express

brainly.com/question/28172855

#SPJ11

Round 2.36 to the nearest whole number

Answers

Answer:

The answer is 2.

Step-by-step explanation:

In 2.36, the whole number is 2. The tenths place, the .3 is lower than 5. Therefore, it will round down to 2.

The number 2.36 would round down to 2

We know that Rounding some number to a specific value is making its value simpler (therefore losing accuracy), mostly done for better readability or accessibility.

Rounding to some place  it accurate on the left side of that place but rounded or sort of like trimmed from the right in terms of exact digits.

We need to round  2.36 to the nearest whole number,

We can see that the 2.36, the whole number is 2. and the tenths place, the .3 is lower than 5.

Hence we can see that, it will round down to 2.

Learn more about rounding numbers  here:

brainly.com/question/1285054

#SPJ6

a bicyclist completes a 100-mile race in 3 hours and 45 minutes. what is the average speed in miles per hour?

Answers

3 hours and 45 minutes = 3.75 hours

\(\frac{100}{3.75}=\boxed{26.\overline{6}}\)

The answer is in the picture attached below
a bicyclist completes a 100-mile race in 3 hours and 45 minutes. what is the average speed in miles per

1,100÷22. I know the answer but I am kinda struggling on how that is possible I checked it on paper but I got the wrong answer every time so could you please explain it to me.​

Answers

Answer:

50 is the answer to this question

Answer:

50

Step-by-step explanation:

Well, you're having trouble with how it's supposed to be 50 right? So I suggest breaking it down a little bit.

As you see:

1100 ÷ 22

1100 and 22 are both divisible by 2 so if we divide both numbers by 2 you get:

550 ÷ 11

now try solving from there!!

If you still don't get it here:

firstly 11 goes into 5 zero times so put nothing

next does 11 go into 55? Yes! it does so how many times does it go into 55?

well let's see: 11 + 11 + 11 + 11 + 11 = 55

now if we count how many 11s there are there is 5! so then you put:

5_

now lets see the next number is 0 and does 11 go into 0? Nope! so we just put:

50 and that is your answer!!

HELP PLEASE
My brain doesn't work today and I need help. My parents don't understand this so I need help

What is the equation in point-slope form of a line that passes through the points (3, −5) and (−8, 4) ?

Responses

y+4=−9/11(x−8)


y−4=−9/11(x+8)

y−4=−1/5(x+8)


y+4=−1/5(x−8)

Answers

Refer to the photo taken.
HELP PLEASEMy brain doesn't work today and I need help. My parents don't understand this so I need helpWhat

You invest $20,000 in the stock market. The stock market then plummets
over the next few weeks. Each day, your investment loses half of its value. How
much will you have invested after 14 days? Write the geometric sequence
formula and show all of your work.

Answers

After 14 days, you will have approximately $2.4414 invested in the stock market.

The amount you will have invested after 14 days can be calculated using the geometric sequence formula. The formula for the nth term of a geometric sequence is given by:

an = a1 x \(r^{(n-1)\)

Where:

an is the nth term,

a1 is the first term,

r is the common ratio, and

n is the number of terms.

In this case, the initial investment is $20,000, and each day the investment loses half of its value, which means the common ratio (r) is 1/2. We want to find the value after 14 days, so n = 14.

Substituting the given values into the formula, we have:

a14 = 20000 x\((1/2)^{(14-1)\)

a14 = 20000 x \((1/2)^{13\)

a14 = 20000 x (1/8192)

a14 ≈ 2.4414

Therefore, after 14 days, you will have approximately $2.4414 invested in the stock market.

For more such answers on ratio

https://brainly.com/question/12024093

#SPJ8

The amount you will have invested after 14 days is given as follows:

$2.44.

What is a geometric sequence?

A geometric sequence is a sequence of numbers where each term is obtained by multiplying the previous term by a fixed number called the common ratio q.

The explicit formula of the sequence is given as follows:

\(a_n = a_1q^{n-1}\)

In which \(a_1\) is the first term of the sequence.

The parameters for this problem are given as follows:

\(a_1 = 20000, q = 0.5\)

Hence the amount after 14 days is given as follows:

\(a_{14} = 20000(0.5)^{13}\)

\(a_{14} = 2.44\)

More can be learned about geometric sequences at https://brainly.com/question/24643676

#SPJ1

Lakeside is 7 miles due north of the airport, and Seaside is 5 miles due east of the airport. How far apart are Lakeside and Seaside? If necessary, round to the nearest tenth.

Answers

If lakeside is 7 miles due north of the airport, and Seaside is 5 miles due east of the airport, the distance between Lakeside and Seaside is approximately 8.6 miles.

To find the distance between Lakeside and Seaside, we can use the Pythagorean theorem, which states that in a right triangle, the square of the hypotenuse (the longest side) is equal to the sum of the squares of the other two sides.

In this case, the distance between Lakeside and Seaside is the hypotenuse of a right triangle with legs of 5 miles and 7 miles.

To apply the Pythagorean theorem, we can square the lengths of the legs and then take the square root of their sum:

distance = √(5² + 7²)

distance = √(25 + 49)

distance = √74

distance ≈ 8.6 miles (rounded to the nearest tenth)

To learn more about distance click on,

https://brainly.com/question/29161253

#SPJ1

Other Questions
Help! will upvte quick! Need to answer two questions at the end ofthe reading. thanks so much!Harvey attended the University of Missouri in Kansas City. majoring in pre-med, and Harvey and Deanne Gilbert were both bom and raised in Kansas City, Missourithen completed medical school at the Univ Find the radius and the interval of convergence of the series (x-2)* KI K. 4 which statement is not correct? c) through obtaining certifications and demonstrating more extensive knowledge, one can show greater expertise and commitment. o all statements are correct. o goals should be specific, measurable, attainable, relevant, and time- bound. o gaining experiences related to a potential career is an invaluable way to learn which and to what degree activities are personally rewarding and enjoyable. Suppose a researcher wishes to edit a gene of interest containing the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' . Design the customized portion of an sgRNA for this target DNA sequence: 5' CUCGUUAGGACUAGUUAGCG who traces its roots to the textile mills in adams, massachusetts, the multinational conglomerate founded by warren buffett and charlie munger is best known for owning geico? You are an investment expert. You have been hired to fully explain to an investment neophyte, the graph below. 15 points. Fundamentals and Stock Price 50.00 3.00 45.00 2.50 40.00 nothing 35.00 2.00 12 Financing choice: On 11 August 2020, to combat the impact of the on-going Covid pandemic, SYD announced a $2 billion equity raising in the form of a rights issue. The rights issue was fully underwritten and renounceable. Information regarding the rights issued can be found here. o Assuming a shareholder does not want to take part in this issue, how much could he/she sell the right for? The closing price of SYD on 10 August 2020 was $5.39. o How would SYD's net leverage ratio calculated as (Total Debt - Cash and Cash Equivalents)/Total Equity and Earnings Per Share (EPS) change after the rights issue. Base your calculations on the 2020 half year financial report as of 31 December 2020. Evaluate this financing choice taking into account the issue of risk, dilution and financing flexibility for future projects. suppose we stock a pond with 130 fish and find that the population is 260 after one year. after several years, the population stabilizes at 7,000. assuming growth has followed a logistic curve. (a) what population size should be maintained to achieve maximum yield and what would be the maximum sustainable yield? (b) if the population is maintained at 4,000 fish, what would be the sustainable yield? work out the curved surface area of this cylinder to 1d.p. two helical compression springs are to be used together with one nested inside the other on a common center-line. the outer spring has an inside diameter of 1.5 in, a wire diameter of 0.125 in, and 10 active coils. the inner spring has an outside diameter of 1.25 in, a wire diameter of 0.092 in and 13 active coils. both springs have the same free length and a modulus of 11.75 mpsi. (a) find the spring constant for each spring. (b) find the force necessary to compress the assembly by 1 in. (c) at a deflection of 1 in, which spring is more highly stressed? this theory teaches that all living creatures have developed through natural processes from that first living cell, and there is no clear idea where that cell came from.what theory is that? it is in the middle of a congressional session and the republican president receives a bill that has passed a democrat-majority house and a democrat-majority senate. this omnibus bill deregulates much of the food industry and agribusiness, something the president has long desired. yet the bill also includes congressional appropriations to help fund modern art museums in san francisco and new york city that the president thinks is unnecessary. which action will the president most likely take? 2. A turtle travels a displacement of 20 m [N]. It then changes direction and travels at a velocity of 0.04 km/hr [E 10o N] for 45 minutes. What is the turtles total displacement? Calculate by drawing a vector diagram. ?011: Show that the vectors v =< 273,-2 > and u =< V3,-1 > are parallel Water flows into a lake at a constant rate.Grace recorded that 400 litres of water flowed into the lake in 1 minute.She recorded the number of litres to the nearest 20 litres.She recorded the time to the nearest10 seconds.Calculate the upper bound for the rate at which the water could have flowed into the lake.Give your answer in litres per second to 2 d.p. plot the genetic code with their triplet code of bases? members of the executive team have asked for an explanation as to why the bit size of an encryption key needs to be higher than the 56-bit rc4 they are using. they show you a screenshot of the research they've done on the powerful desktop computer they run, saying that none of the keys they are using will be in production for more than a year. they want to just keep using the smaller keys. how would you answer them? for two events, a and b, p(a) = 0.4, p(b) = 0.2, and p(a b) = 0.1. a. find p(b|a).b. find p(a|b).c. are a and b independent event? c)Use the limit comparison test to determine whether en = an = 4n3 2n2 + 9 converges or diverges. 8 + 6n4 n=9 n=9 1 (a) Choose a series bn with terms of the form bn = a - and apply the limit In triangle ABC, side a = 5 units long, side b = 7 units long, side c = long. Find the measurement of angle A.