fill in the blanks in the convos below with correct form of estar. will give brainliest!!

Fill In The Blanks In The Convos Below With Correct Form Of Estar. Will Give Brainliest!!

Answers

Answer 1
1. estas
2.está
3.están
4.estoy
5.estamos
Answer 2
1.estas (how are you)
2.está (there)
3.están (they are)
4.estoy (Im in/here)
5.estamos (we are)

Related Questions

how to conjugate cantar

how to conjugate cantar

Answers

Cantar Conjugation: Present Tense

yo canto
tú cantas
él/ella canta
nosotros/as cantamos
vosotros/as cantáis
ellos/ellas cantan
Yo canto
Tu cantas
El/ella canta
Nosotros cantamos
Ustedes cantan
Ellos cantan

Someone plz help me quick

Someone plz help me quick

Answers

The first one is the right answer!!!

Which two spanish letters are considered borrowed letters, meaning they are not used in any authentic spanish words?

Answers

Answer:

w, k

Explanation:

The letters are:

k, w

...

Juego 5B: Sopa de letras please i just need these 3 then im done ive been stuck for 2 hours

Juego 5B: Sopa de letras please i just need these 3 then im done ive been stuck for 2 hours

Answers

The answer is quadupllo try finding it
10 would be Traigo and 11 is Rico

Hay que crear reglas de proteccíon del medio ambiente

Answers

Answer:

Fundación Leyes Ambientales y de Conservación:

Ley de antigüedades.

Ley de especies en peligro de extinción.

Acta para el aire Limpio.

Ley de Agua Limpia.

Fondo de Conservación de Tierras y Aguas.

Ley Nacional de Política Ambiental.

What does the underlined word mean in the following sentence?
Babe Ruth es mi jugador favorito de béisbol.
football
basketball
O sports
baseball

Answers

béisbol means baseball the answer is d

Answer:

d

Explanation:

Please help me on this.

Please help me on this.

Answers

Answer:

Explanation:

Con soldados

Inexpertos, ante un ejército francés que

Nunca había sido derrotado, pero con

Coraje y valentía, te levantaste con

Orgullo y rechazaste al invasor.

If someone can do 1-12 for me then you will be a lifesaver! Please if you can answer! Due tonight!

If someone can do 1-12 for me then you will be a lifesaver! Please if you can answer! Due tonight!

Answers

1.) Vienen
2.) Vienes
3.) Tenemos
4.) Tiene
5.) Tengo, Tiene
6.) Tienen
7.) Tienen
8.) Viene, Vengo
9.) Tenemos
10.) Tienes
11.) Tengo
12.) Vienen

Hope this helps :)

Unidad 2
Lección A
Vocabulario A1
1 Crucigrama
Haz el siguiente crucigrama.
4
10
Horizontales
Verticales
3. Para lavarte las manos, abres el__
5. Te lavas las manos con agua y
1. Te bañas en una
2. Te peinas el pelo con un
4. En un baño, hay una ducha, un
lavabo y un
6. Te miras en un
7. Cuando nos
nos ponemos ropa.
8. Te secas con una
9. Para afeitarte, necesitas__ de afeitar.
10. Te lavas el pelo con

Unidad 2Leccin AVocabulario A11 CrucigramaHaz el siguiente crucigrama.410HorizontalesVerticales3. Para

Answers

Answer:

1 Tina

2 peine

3 grifo

4 inodoro

5 jabón

6 espejo

7 vestimos

8 toalla

9 crema

10. Champu

Las palabras adecuadas para completar el crucigrama en cada caso son:

TinaPeineGrifoInodoroJabónEspejoVestimosToallaCremaChampú

Elección de palabras.

Para seleccionar la palabra adecuada, se debe identificar a partir de una de las opciones encontradas, que esta concuerde con otra palabra que se encuentre en la intersección.

Por ejemplo, al encontrar la palabra 8 "toalla" se debe verificar que la cuarta letra de la palabra 7 sea la t (vestimos), la última letra de la palabra 9 sea una a (crema) y que la tercera letra de la palabra 10 sea una a (champú).

Si quieres aprender más sobre Crucigramas, puedes visitar el siguiente enlace: https://brainly.com/question/25574938

1. Marta Luz y yo ________ al centro comercial.

Answers

Answer:

miramos

Explanation:

Answer:

Fuimos, vamos, o  vamos a ir

Explanation:

Someone help please!

Modelo
¿Dónde está tu amiga? (Barcelona)
Mi amiga está en Barcelona.

1) ¿De dónde son los amigos de ustedes? (puertorriqueños)
2) ¿Cómo son los hermanos de Pilar? (simpáticos)

I'm a little confused.

Answers

Answer:

1. Mis amigos son de Puerto Rico.

2. Los hermanos de Pilar son simpáticos.

Explanation:

1. Mis amigos son de Puerto Rico.

2. Los hermanos de Pilar son simpáticos.

La explicación de las partes anteriores del discurso.

1. "Mis amigos" is the subject of the sentence and is in plural form. "Son" is the verb "to be" in third person plural. "De Puerto Rico" is a prepositional phrase indicating the origin or nationality of "mis amigos."

2. "Los hermanos de Pilar" is the subject of the sentence and is in plural form. "Son" is the verb "to be" in third person plural. "Simpáticos" is an adjective describing the quality of "los hermanos de Pilar."

Learn more about amigos  at:

https://brainly.com/question/33327082

#SPJ6

Para formar el mandato formal, quita la -o. En el caso del verbo correr", ya que termina en -er, cambia el
verbo a la terminación opuesta. Es decir, la conjugación del mandato formal para correr es.
corro
corre
Corra
corres

Answers

Answer:

corra

Explanation:

Answer: Corra

Explanation: because tacos

¡A mí me encanta el baloncesto! Mis padres compraron boletos para mí para ver un partido de Los Angeles Lakers esta noche.

Mis padres ________ compraron.

me lo
se los
me los
se lo

Answers

Mis padres Se los compraron


Mis padres me los compraron.

Hope this will help

¿Consideras que la unidad es importante en la familia?

Answers

Si, es muy importante.

Answer:

La unidad familiar es muy importante porque todos quieren ser parte de algo. Si los niños no sienten que sus familias son algo especial e importante de lo que formar parte, encontrarán otros grupos en los que se sientan incluidos y queridos. Los niños comenzarán a notar las tradiciones y las esperarán con ansias.

Explanation:


please help, I'm failing Spanish and have no idea what any of this means ​

please help, I'm failing Spanish and have no idea what any of this means

Answers

Answer: me,le,te,nos,les,me,le,les,te,le,nos,,le,me,te,nos

A pedro le gusta comer pizza

A tí te gusta dibujar

A mi me gusta ayudar en casa

A Julio y Ana les gusta pasar tiempi con

amigos

A enrique y tú les gusta hacer la tarea

Explanation:

ms spanish 2A quarter 1 exam answers

Answers

Okay for the answers for Spanish

Aníbal and Jaime, two exchange students from Spain, are trying to get to know all the other Spanish speakers on their
floor. Fill in the blanks with the appropriate forms of the verb ser in their conversation

Answers

Answer:

where are the conversations, so that I can fill in the missing blanks?

Explanation:

instructions:
cuales son Los infinitivos de estos verbos

what are the infinitives of these verbs.

Me aquesto Temprano______
2. Mi abuela duerme mucho__
3. Queremos Salir
4. Juegan al futbol_________
5. Vuelvo a las tres________
7. Mi hermano se despierta tarde de los savados______
8. Yo prefiero las matematicas___________
9. Mi madre se viste rapidamente___________
10. Tu quieres ver ese______ programa_______________

plzz☹️ help me ​

Answers

1. Acostar
2. Dormir
3. Querer
4. Jugar
5. Volver
7. Despertar
8. Preferir
9. Vestir
10. Querer

Emparejar
Select the correct action for each location. Two actions will not be used.
el cine
la clase de francés
el estadio
el museo
el restaurante

Answers

The matches for the correct action for each location:
- El cine: Consiguen ver una buena película.
- El estadio: Ana dice que va a ganar.
- El museo: Sigo al guía.
- El restaurante: Pedimos pizza.
- La clase de francés: Repiten los verbos.

Translation

The matches for the correct action for each location:

- The cinema: They get to see a good movie.

- The stadium: Ana says she's going to win.

- The museum: I follow the guide.

- The restaurant: We order pizza.

- The French class: They repeat the verbs.

The complete question is:

Select the correct action for each location. Two actions will not be used.

el cine                                  el estadio                            el museo                              el restaurante                      la clase de francés    

d. Consiguen ver una buena película.

e. Ana dice que va a ganar.

a. Sigo al guía.

f. Pedimos pizza.

b. Repiten los verbos.

learn more about locations in Spanish

https://brainly.com/question/11801959

#SPJ11

Cual es el conector de la oracion traicionastes mi confianza por eso no te perdono

Answers

Answer:por eso

Explanation:

De que se trata el poema de José Martin en ti pensaba, en tus cabellos

Answers

Este poema de José Martín se trata del amor que siente el autor hacía una mujer y su admiración hacia la misma.

¿De qué se trata el poema "En ti pensaba, en tus cabellos"?

El poema de José Martín conocido como "En ti pensaba, en tus cabellos" es un poema sobre el amor. En este poema el autor se refiere a la mujer que ama y la describe, por ejemplo en la frase "En ti pensaba, en tus cabellos, / los grandes árboles del Trópico" el autor compara el hermoso cabello de la mujer con la naturaleza.

Por lo tanto, en el poema José Martín se refiere a los atributos de la mujer que ama.

Aprenda sobre poemas en https://brainly.com/question/30987742

#SPJ1

Need help make up assignment

Need help make up assignment

Answers

The answer is: está
Answer would be Esta

The difference of two numbers is 4 and their product is 60. Find the numbers.​

Answers

Answer: the two numbers will be ( 6 and 10 ) or ( -6 and -10 )

Explanation:

Prompt
Translate the following sentences:
1. Don't drive so fast! (usted)
2. The party's over. Everybody out now!
3. Let's eat at this table.
*Note: This is a practice activity. Completing this activity will not only prepare you for future tests and
more importantly, it will enhance your language ability. This activity will not count towards your grade.

PromptTranslate the following sentences:1. Don't drive so fast! (usted)2. The party's over. Everybody

Answers

Answer:

Explanation:

1. ¡No conduzca tan rápido!

2. Se acabó la fiesta. ¡Todo el mundo fuera de aqui ahora!

3. Comamos en esta mesa.

Don't drive so fast!: ¡No conduzca tan rápido!The party's over. Everybody out now!: Se acabó la fiesta. ¡Todo el mundo fuera de aqui ahora!Let's eat at this table: Comamos en esta mesa.

Es sólo conocer la gramática y el vocabulario del español.

MissSpanish

porque hacen rituales en el dia de muertos​

Answers

Answer:

Sí, ellos o nosotros hacemos eso cuando comenzó del 1 de noviembre al 2 de noviembre

Explanation:

marcame el más inteligente por favor Translation :EnglishAnswer:Yes, they or we do that when it started from November 1 to November 2Explanation:mark me the smartest one please.
Para recordar a los que ya an pasado a la otra vida/fallecido.

what if the population of mexico city?

Answers

Answer: 22,085,000

Explanation:

The current metro area population of Mexico City in 2022 is 22,085,000, a 0.76% increase from 2021

El _____________ gordo. fill in the blank

Answers

El es/esta gordo depending on past or present

Answer:

Está

Explanation:

El está gordo.

Tengo que tomar clases de actuación para ser ___________.

Answers

It should be Actor/Actriz depending whether it male or woman; woman being “actriz”

Answer:

⇒  actor.                                                      

Explanation:

Tengo que tomar clases de actuación para ser actor.            

...

1 Conjugue les verbes au passé composé.
a. Nosotras (encontrar)... pistas.
b. Esta noche, tú (oír)... al ladrón.
Construis deux phrases au passé composé.
a. Entrar en / el museo / los ladrones/ hoy.
b. Tú / recuperar la obra / conseguir.

Answers

Nosotros encontramos pistas
Esta noche tu escuchaste al ladrón
Hoy los ladrones entran en el museo
Conseguir recupera la obra tu

Complete the sentences below with the appropriate words from the left side of the table. Remember to
conjugate verbs when necessary.

Complete the sentences below with the appropriate words from the left side of the table. Remember toconjugate

Answers

1. Una cuchara
2. Un cuchillo
3. La cena
4. El desayuno
5. Frutas
6. Verduras
7. Ensalada
8. Tiene hambre
9. Tengo sed
Other Questions
built into the cisco ios; solve many problems associated with traffic flow and security. T/F The black bellied seed cracker, Pyrenestes, is a West African finch. Within the same geographic region, two subspecies of the finch are found. One subspecies has a large beak, which is efficient at cracking the hard seeds of the sedge, Scleria verrucosa. The other subspecies has a small beak, which is more efficient at eating the soft seeds of the sedge, Scleria goossensii. What type of selection occurred to produce this situation which of the following products allows the seller to identify different groups of consumers (segment the market) and practice price discrimination? a cafe latte sold at starbucks tickets to matinee shows at a movie theatre clothing items sold through macy's department store a hamburger sold at burger king I was disconnected octetwhy does an atom want to have a filled orbital? Help! Diesel mechanics___________while diesel electronics_________ How is the effect of half rhyme different to the effect of rhyme? Minta wants to increase the heat transfer between a metal iron and another piece of metal he wants to see if he decides to increase the time the two metals are in contact use a large larger metal iron and use the new metal material from a higher specific heat (x>0,|x - 5 > 2x +1. Arrange the steps in shipping and receiving merchandize in the correct order.1.shipment of goods2.receiving goods3.order fulfillment4.inventory control multiple choice question what is the likelihood that two heterozygous brown eyed individuals (bb) would produce three out of four offspring that have brown eyes? multiple choice question. 0.50 or 50% 0.42 or 42% 0.26 or 26% 0.75 or 75% 0.105 or 10.5% how many bright fringes are seen in the central maximum that spans the distance between the first missing order on one side and the first missing order on the other side? The total surface area of cube is 54cm2.what is the height of the cube How does Coates having rejected manic in all its form conflict with this world view if you are in a car that is struck from behind, you can receive a serious neck injury called whiplash. using newton's laws of motion, explain what happens to cause the injury. how does a headrest reduce whiplash? Find the area of the figure. (Sides meet at right angles.)5 m4 m4 m3 m3 m3 m m what type of covalent bond between amino acid side chains (r groups) functions in a polypeptide's tertiary structure? if sin just answer the please lol i don't feel like typingASAP Please help me!A person saves $200 a month. If her annual income is $32,000 per year, what percent of her income is she saving? can you please compare the DNA sequences in thisimage, mark any insertion, deletion, polymorphism, and addition.Discuss about the yellow region in sequences and the nucleotides.discuss all the simi>M12-LCMT-F_D02.ab1TAAAGCCATTTACCGTACATAGCAC >M13-LCMT-F E02.ab1TAAAGCCATTTACCGTACATAGCAC >M14-LCMT-F_F02.ab1TAAAGCCATTTACCGTACATAGCAC325 >M15-LCMT-F_G02.ab1TAAAGCCATTTACCGTACATAGCAC >M16-LCMT-F_H02.ab1TAAAGCCATTTACCGTACATAGCAC>M12-LCMT-F_D02.ab1ATTACAGTCAAATCCCTTCTCGTCC>M13-LCMT-F_E02.ab1ATTACAGTCAAATCCCTTCTCGTCC >M14-LCMT-F F02.ab1ATTACAGTCAAATCCCTTCTCGTCC350>M15-LCMT-F G02.ab1ATTACAGTCAAATCCCTTCTCGTCC>M16-LCMT-F_H02.ab1ATTACAGTCAAATCCCTTCTCGTCC w >M12-LCMT-F_D02.ab1CCATGGATGACCCCCCTCAGATAGG>M13-LCMT-F_E02.ab1CCATGGATGACCCCCCTCAGATAGG >M14-LCMT-F_F02.ab1CCATGGATGACCCCCCTCAGATAGG375 >M15-LCMT-F_G02.ab1CCATGGATGACCCCCCTCAGATAGG>M16-LCMT-F_H02.ab1CCATGGATGACCCCCCTCAGATAGG>M12-LCMT-F_D02.ab1GGTCCCTTGACCAC>M13-LCMT-F_E02.ab1GGTCCCTTGACCAC >M14-LCMT-F_F02.ab1AGTCCCTTGACCAC >M15-LCMT-F_G02.ab1GGTCCCTTGACCAC>M16-LCMT-F H02.ab1GGTCCCTTGACCAC 400 Tarek will spend at most $26 on gifts. So far, he has spent $14. What are the possible additional amounts he will spend?Use c for the additional amount (in dollars) Tarek will spend.Write your answer as an inequality solved for c.