Construct a hypothesis to explain how the genes inherited by an individual can affect an individual’s health and/or cause certain genetic disorders.

Answers

Answer 1
A possible hypothesis to explain how inherited genes can affect an individual's health and/or cause certain genetic disorders is:

"Genetic disorders and health conditions can be caused by mutations or variations in specific genes that are inherited from parents. These mutations can alter the function or expression of proteins, enzymes, or other molecules involved in various physiological processes, leading to abnormal development, metabolism, or immune responses. The severity and manifestation of these disorders may depend on the type, location, and frequency of the mutations, as well as the interactions with other genetic or environmental factors. Therefore, understanding the genetic basis of these disorders and identifying the underlying mutations can help in diagnosing, preventing, or treating these conditions."

Related Questions

How did nationalist feelings endanger the austro-hungarian empire?.

Answers

The nationalist feelings endangered the austro-hungarian empire through  the Slavic groups within the country kept fighting for independence.

What is Independence?

This is defined as the freedom from being ruled by another country. Most countries gained independence from countries which ruled them in the past.

In the case of the Austro-hungarian empire, the Slavic groups kept fighting for independence thereby endangering the empire.

Read more about Independence here https://brainly.com/question/9515546

When using the meter gate, you must account for some "slop" in the handle. What do we call this and why must you account for it

Answers

Backlash is a phrase frequently used to describe the slop or play in a metre gate's handle.

Backlash is the space between mated components, such as gears or threads, that permits some play or movement. The precision of measurements in a metre gate might be impacted by blowback. Due to backlash or play in the gears or threads, the handle may need to be twisted a specific amount before the gate truly starts to move when it is opened or closed.

As a result, when the handle is cranked, the gate may not really open right away, which might result in inaccurate flow or volume measurements. When taking measures with a metre gate, more handle twisting is necessary to overcome clearance in the gears or threads in order to account for this backlash.

Read more about gears on:

https://brainly.com/question/117908

#SPJ4

Which of these is the best reason for nina to monitor her bank account statements online or on her cell phone app? to know when her bills are due to determine the exact date she can retire to ensure she's paying her fair share in taxes to know how much money she has for budgeting.

Answers

The best argument for Nina to check her checking account records online or on a mobile app is to determine how much cash she has to work with while creating a budget.

What exactly accounts?

In an accounting system, a profile is a record that keeps track of the financial transactions involving a particular asset, risk, equity, profit, or expense. As that the business events take place throughout the course of the accounting period, these records grow and shrink.

Which account type is a business?

A corporate checking account, like a checking account, is frequently employed for an institution's regular transactions, such buying things or paying bills. Businesses are given checks and debit cards to use for purchases, and they can deposit money into and take money from these accounts.

To know more about account visit:

https://brainly.com/question/22917325

#SPJ4

Answer:

b-to determine the exact date she can retire

Explanation:

.

The tissue, at the top of this slide, is simple columnar epithelium and can be found in our intestines. Kellot OFPONSOR 7 N SIMPLE COLUMNAR Select one: True False
Name the bone seen here. Select one:

Answers

The given statement, "The tissue, at the top of this slide, is simple columnar epithelium and can be found in our intestines" is true.

The epithelial tissue found in our intestines is known as simple columnar epithelium. The simple columnar epithelium has column-shaped cells, which are elongated and taller than their width. These cells have a single nucleus and have a goblet cell that secretes mucus to lubricate the surface. It lines the gastrointestinal tract, uterus, and excretory ducts. Therefore, the given statement is true.The bone shown in the given image is the femur bone. The femur bone is the longest and strongest bone in the human body.

It is located in the thigh region and extends from the hip joint to the knee joint. The femur bone is responsible for supporting the entire weight of the body when a person is standing or walking. It is composed of the head, neck, shaft, and distal ends. The head of the femur bone fits into the acetabulum socket of the hip bone to form the hip joint. The distal end of the femur bone articulates with the tibia bone to form the knee joint.

Therefore, the given bone in the image is the femur bone.

know more about columnar epithelium click here:

https://brainly.com/question/30765951

#SPJ11


Which procedure took the DNA from one sheep to produce a genetically identical lamb, named Dolly?
selective breeding
gene therapy
artificial selection
cloning

Answers

Answer:

Cloning

Explanation:

If you take DNA and make a genetically identical thing with that DNA it would be cloning

Answer

D cloning

Explanation:

i just took the quiz and made a 100

The shape of the earth’s orbit is known as______ it can change from almost a perfect circle to
The shape of earth's orbit is known as
elliptical (egg like).
O obliquity
O precession
O orbit
O eccentricity

Answers

Answer:

A.

Explanation:

Because the other ones do not make sense.

darwin did not know about genes but believed that traits passed from parents to offspring by particles called?

Answers

Darwin did not know about genes but believed that traits passed from parents to offspring by particles called gemmules.

Asexual reproduction is carried out via gemmules, which are internal buds that are found in sponges. It is a collection of cells that reproduces asexually and has the potential to grow into an adult sponge.

In sponges, asexual reproduction takes place through budding from either internal or exterior buds. Gemmules are the name of the interior buds. Only sorts of buds that are endogenous give rise to young sponges.

Gemmules can stay still for a long time because they are resistant to desiccation, freezing, and anoxia (lack of oxygen). Similar to a bacterium's endospore, gemmules are composed of amoebocytes and are covered in a coating of spicules. They can survive conditions that would kill adult sponges. The gemmule resumes growing when its surroundings are no longer hostile.

To know more about gemmules click here:

brainly.com/question/13048858

#SPJ4

Which is an example of antiracist behavior?
A. Rachel pretends she didn't hear a negative comment about
Latinos.
B. Rachel mentions that some of her best friends are Latino.
C. Rachel says it's wrong to say negative things about Latinos based
on a stereotype.
O D. All of the above

Answers

I think it’s C because it can’t be D because A is not anti racist

_____ is a term used to describe the influences of multiple genes on behavior.

Answers

The term used to describe the influences of multiple genes on behavior is called "polygenic inheritance."It refers to the transmission of characteristics from one generation to the next in which several genes determine the phenotype of an organism.

When traits or characteristics are determined by more than one gene, they are said to be polygenic. Examples of polygenic inheritance include height, weight, skin color, and eye color. A polygenic inheritance occurs when several genes contribute to a particular trait or characteristic in an organism.

Since most traits are influenced by multiple genes, polygenic inheritance is common in many organisms, including humans. Complex behaviors like language, intelligence, and personality are also believed to have a polygenic basis.

The study of polygenic inheritance is essential for the understanding of complex traits. In most cases, it involves identifying the genes involved in the inheritance of a particular trait, analyzing the interactions between them, and determining how they contribute to the trait's expression.

Polygenic traits tend to exhibit a continuous range of variation rather than discrete categories. That is, the trait is not an either/or situation. Instead, it is a continuum, where individuals fall somewhere along a spectrum.

For example, height in humans is a polygenic trait that shows a continuous distribution of values from short to tall. This continuous distribution results from the combined effects of several genes, each of which contributes a small amount to the overall height of an individual.

To know more about polygenic inheritance here

https://brainly.com/question/30458555

#SPJ11

Which of these describes passive immunity? A.It occurs on the binding sites of antibodies. B.It is immunity that occurs after your body recovers from an illness. C.It is immunity from by a vaccine. D.It is immunity transferred from a mother nursing baby.

Answers

Answer:

C

Explanation:

Becuase fom a vaccine you are recieving antibodies by another animal or human donor.

D is unlinkely since it describes how the mother is nursing the baby, so nothing directly mentioning of the baby recieving any antibodies. The other options also talk about how the body creates its own antibodies, which isn't passive immunity.

what are the four major blood vessels in the heart

Answers

ANSWER:

The four major blood vessels in the heart are:

1. Aorta: The aorta is the largest artery in the body and carries oxygenated blood from the left ventricle of the heart to the rest of the body. It distributes oxygen-rich blood to various organs and tissues.

2. Pulmonary Arteries: The pulmonary arteries carry deoxygenated blood from the right ventricle of the heart to the lungs for oxygenation. There are two pulmonary arteries, one for each lung.

3. Superior Vena Cava: The superior vena cava is a large vein that carries deoxygenated blood from the upper body and arms back to the right atrium of the heart. It collects blood from the head, neck, upper limbs, and upper chest.

4. Inferior Vena Cava: The inferior vena cava is another major vein that carries deoxygenated blood from the lower body and legs back to the right atrium of the heart. It collects blood from the abdomen, pelvis, and lower limbs.

These four major blood vessels play crucial roles in the circulation of blood within the heart and throughout the body, ensuring the delivery of oxygen and nutrients to various tissues and the removal of waste products.

the following substances all move across the plasma membrane of red blood cells by diffusion. which ones move by facilitated diffusion?

Answers

The substances that move by facilitated diffusion are 1) glucose , 2)chloride ions and 3)bicarbonate ions.

Gases (inclusive of O2 and CO2), hydrophobic molecules (inclusive of benzene), and small polar however uncharged molecules (inclusive of H2O and ethanol) are capable of diffuse throughout the plasma membrane. Some molecules, inclusive of carbon dioxide and oxygen, can diffuse throughout the plasma membrane directly, however others want assist to pass its hydrophobic core. In facilitated diffusion, molecules diffuse throughout the plasma membrane with help from membrane proteins, inclusive of channels and carriers. Facilitated diffusion is diffusion this is helped along (facilitated by) a membrane shipping channel. These channels are glycoproteins (proteins with carbohydrates attached) that permit molecules  via the membrane.

To learn more about diffusion check the link below-

https://brainly.com/question/94094

#SPJ4

Complete question-

The following substances all move across the plasma membrane of red blood cells by diffusion. Which ones move by facilitated diffusion?

1) glucose

2)chloride ions

3)bicarbonate ions

4)oxygen


Pls help I’m so confused :(

Pls help Im so confused :(

Answers

Answer:

Left is synthesis, right is digestion

Explanation:

Synthesis refers to the creation of a product, whereas digestion refers to the breakup of the reactant or initial substance.

in males, both the urinary system and the _________ use the urethra.

Answers

The renal cortex is the smooth-finished region stretching out from the renal container to the foundations of the renal pyramids and into the spaces between them.

These regions are the ureteropelvic intersection (UPJ), the ureterovesical intersection (UVJ), and the hybrid of the normal iliac supply routes. The UPJ is where the pelvis of the kidney advances into the ureter and the UVJ is where the ureters enter the bladder.

The foot processes known as pedicels that stretch out from the podocytes fold themselves over the vessels of the glomerulus to shape the filtration cuts. The pedicels increment the surface region of the cells empowering proficient ultrafiltration.

To learn more about The renal cortex here

https://brainly.com/question/13146763

#SPJ4

What type of DNA evidence is used today in studying phylogenetics?

Answers

Answer:

Any DNA, RNA, or protein sequences can be used to draw a phylogenetic tree. But DNA sequences are the most widely used.

which of the following statements is true of linked genes?multiple choice question.they do not assort independently and do not produce mendelian ratios for crosses tracking two or more genes.they do assort independently but do not produce mendelian ratios for crosses tracking two or more genes.

Answers

The correct statement is: They do not assort independently and do not produce Mendelian ratios for crosses tracking two or more genes.

Linked genes are genes that are located close to each other on the same chromosome.

Unlike genes that are located on different chromosomes, linked genes tend to be inherited together as a result of their physical proximity. This means that they do not assort independently during meiosis, breaking the principle of independent assortment proposed by Gregor Mendel.

When two or more genes are linked, their inheritance does not follow the expected Mendelian ratios observed for unlinked genes.

In Mendelian genetics, genes located on different chromosomes segregate independently into gametes and produce predictable ratios in offspring.

However, linked genes tend to stay together and are less likely to undergo recombination, resulting in deviations from Mendelian ratios in crosses involving multiple linked genes.

The phenomenon of genetic linkage and its impact on inheritance was one of the key discoveries in genetics that provided evidence for the existence of chromosomes and helped develop the concept of genetic mapping.

To know more about "Mendelian ratios" refer here:

https://brainly.com/question/31553594#

#SPJ11

URGENT!!
Write a methodology for this topic:

Lactic acid fermentation in sports performance

Answers

The methodology for the Lactic acid fermentation in sports performance are as follows-

Inquire about the plan: This ponder will utilize a randomized controlled trial plan, with members haphazardly doled out to either a test or control bunch.Participants: They think about will enlist male and female competitors matured 18-35 a long time who lock in high-intensity preparation exercises, such as sprinting, weightlifting, and powerlifting. Members will be required to supply educated assent, have no pre-existing therapeutic conditions, and not be taking any medicines that seem to influence their execution. Intervention: Members within the exploratory bunch will be given a lactic acid buffering supplement, such as sodium bicarbonate, whereas those within the control gather will get a fake treatment. The supplement will be managed 30 minutes earlier than their preparation sessions.Information collection: The ponder will collect information on the participants' execution, counting their control yield, time to weariness, lactate edge, and heart rate changeability. These estimations will be taken some time recently and after the mediation. Blood tests will moreover be collected to degree lactate levels. Data analysis: The information will be analyzed utilizing a factual computer program to decide any noteworthy contrasts between the test and control bunches. A two-tailed t-test will be utilized to compare the implies of the two bunches, and a p-value of less than 0.05 will be considered measurably critical.Ethical contemplations: The think will take after moral rules for inquiring about including human subjects, counting getting educated assent from members and keeping up their secrecy. Members will be educated on the potential dangers and benefits of support and will have the proper to pull back from the consideration at any time. Any unfavourable occasions will be detailed to the suitable specialists.

To learn more about Lactic acid,

https://brainly.com/question/14392019

#SPJ1

Rain washing oily runoff from a road into a river that runs alongside the road is an example of point source pollution or nonpoint source pollution?

Help pls.

Answers

Answer:

This would be an example of nonpoint source pollution.

Explanation:

The source of point source pollution is typically factories and powerplants, leading to more air and water transferred pollutants and becoming easier to track. Nonpoint source pollution is the opposite of point-source pollution, with pollutants being released in a wide area. Since the rainwater would be washing the oils and particles into the water, it would be considered runoff. Runoff is one of the leading causes of point source pollution. I hope this helps. ^_^

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

After ricks are changed by the processes of weathering and erosion they become?

Answers

After rocks are changed by the processes of weathering and erosion they become sediments.

Weathering include wind and river which  changes the bigger rocks into smaller ones. Erosion and weathering combined then convert it into sediments.

The rain which is acidic in nature when drops on the rocks, it starts to erode the rock. These smaller rocks then mix with substances like sand and become sedimentary rocks.

There are two types of sedimentary rocks; the first one is known as  detrital rock made up of rock fragments, and sediment and the second one is known as chemical rock made from the  dissolution and precipitation of minerals.

If you need to learn more about sediments, click here

https://brainly.com/question/22443465?referrer=searchResults

#SPJ4

evolution by natural selection is an example of a scientific

Answers

Answer:

Ideas aimed at explaining how organisms change, or evolve, over time date back to Anaximander of Miletus, a Greek philosopher who lived in the 500s B.C.E. Noting that human babies are born helpless, Anaximander speculated that humans must have descended from some other type of creature whose young could survive without any help. He concluded that those ancestors must be fish, since fish hatch from eggs and immediately begin living with no help from their parents. From this reasoning, he proposed that all life began in the sea.

Have no idea hopefully some1 can help you

Which is the function of the lymphatic system?

A. To transport gases
B. To protect internal organs
C. To control movement
D. To transport fats

Answers

The fiction of the lymphatic system is to transport fats. (D)

When an object is moved, _____________ occurs.
A) power

B) force

C) work

Answers

Answer: Its B.) Force.

Explanation: Nice profile pic :)

Answer:

B) force

Explanation: hope this helps ;)

Three alleles exist for human blood types. They were not numbered, but instead marked with the letters for A,B and O. The labelling convention is: IA, IB and Ii. IA and IB are codominant alleles, whereas Ii is the recessive type O. Humans are diploid; every individual carries only two alleles. 1.) List all possible blood group genotypes. 2.) How many kinds of homozygotes are there? 3.) How many kinds of heterozygotes are there? 4.) There are only 4 blood group phenotypes (A, B, AB and O). Based on the information given here , list the genotypes that produce each phenotype. a.) type A b.) type B c.) type AB d.) type O

Answers

1.) The possible blood group genotypes are: IAIA, IAIB, IAi, IBIB, IBi, ii.
2.) There are three kinds of homozygotes: IAIA, IBIB, and ii.
3.) There are three kinds of heterozygotes: IAIB, IAi, and IBi.
4.) The genotypes that produce each phenotype are:
a.) Type A: IAIA or IAi
b.) Type B: IBIB or IBi
c.) Type AB: IAIB
d.) Type O: ii

It is important to note that the IA and IB alleles are codominant, meaning that they both express their respective traits when present. The Ii allele, however, is recessive and only expresses the type O phenotype when two copies are present. This is why there are only four blood group phenotypes despite the presence of three alleles.

To know more about homozygotes click on below link:

https://brainly.com/question/29455764?#

#SPJ11

Use evidence from the diagrams of macromolecules and information provided earlier to revise your explanation about whether sugar molecules provide all the elements needed to make the four types of macromolecules.

Answers

All the elements that  needed to make the four types of the  macromolecules which cannot be gotten from only the sugar molecules.

Macromolecules are those biological molecules that are also essential for life. There are mainly four main types of these molecules and they have include: the Protein the Carbohydrates Lipids and the Nucleic acids. All the above mentioned macromolecules have the carbon, the hydrogen and the oxygen in their chemical structure with the exception of the nucleic acids and the proteins which contains the nitrogen as an the additional molecule. From the diagram that attached, the chemical structure of the sugar molecule which shows that it's made up of the carbon, oxygen and the hydrogen atoms only. Because there is no in the nitrogen in the sugar molecule, it cannot be provide all the elements needed to make the four types of the macromolecules.

This following question is incomplete the complete question is :

Use evidence from diagrams of the macromolecules and the information provided earlier to the revise your explanation about if sugar molecules which provide all the elements needed to make the four types of the macromolecules.

To know more about Macromolecules visit:

https://brainly.com/question/13277913

#SPJ1

Use evidence from the diagrams of macromolecules and information provided earlier to revise your explanation

The genus Cnemidophorus is a large group of whiptail lizards that are found in both North and South America. These lizards undergo a process in which their unfertilized eggs can develop into new individuals. This process is called

Answers

Answer: The question is not complete, options are not given but here are the options from another websites.

a. sexual reproduction.

b. binary fission.

c. parthenogenesis.

d. budding.

The correct option is C.

Parthenogenesis.

Explanation:

lizards undergo a process in which their unfertilized eggs can develop into new individuals and the process is called parthenogenesis because parthenogenesis is a reproductive strategy that involves the reproduction of new organisms without undergoing fertilization or the production of new organisms from unfertilized eggs and these can be as a result of the lizard not able to undergo sexual reproduction which can be as a result of environmental factors. This process does not involve sexual reproduction.

How much net work is required to accelerate it from rest to a rotation rate of 1.00 revolution per 8.80 s ? Assume it is a solid cylinder. Express your answer using three significant figures and include the appropriate units.

Answers

The net work required to accelerate the cylinder from rest to a rotation rate of 1.00 revolution per 8.80 s is approximately 0.0199 J, rounded to three significant figures.

To determine the amount of net work required to accelerate a solid cylinder from rest to a rotation rate of 1.00 revolution per 8.80 s, we need to use the formula for rotational kinetic energy:
KE = (1/2)Iω^2
where KE is the kinetic energy, I is the moment of inertia, and ω is the angular velocity.
Since the cylinder is initially at rest, its initial kinetic energy is zero. Therefore, the net work required to accelerate it to the given rotation rate is equal to its final kinetic energy, which we can calculate using the formula above.
First, we need to find the moment of inertia of the cylinder. For a solid cylinder, the moment of inertia is given by:
I = (1/2)MR^2
where M is the mass of the cylinder and R is its radius.
Assuming the cylinder has a mass of 1 kg and a radius of 0.5 m, we can calculate its moment of inertia:
I = (1/2)(1 kg)(0.5 m)^2 = 0.125 kg m^2
Now, we can calculate the final kinetic energy of the cylinder:
KE = (1/2)(0.125 kg m^2)(2π/8.80 s)^2 = 0.0199 J
Therefore, the net work required to accelerate the cylinder from rest to a rotation rate of 1.00 revolution per 8.80 s is approximately 0.0199 J, rounded to three significant figures.

To know more about kinetic energy visit: https://brainly.com/question/999862

#SPJ11

How is volvox life different than euglena life?

Answers

Answer:

Paramecium have cilia to move/eat, but euglena have flagella to move. How are euglena and volvox similar and different? Both can make their own food using chloroplasts (autotroph), but euglena can also hunt for their food. Both also use flagella to move, but volvox move together in colonies.

Explanation:

Which sentence best describes a monarch butterfly as a living system that is one part of a more complex system

Answers

A monarch butterfly can be described as a living system that is one part of a more complex system. As a living system, the monarch butterfly possesses various characteristics and functions that allow it to survive, reproduce, and interact with its environment.

Firstly, the monarch butterfly undergoes a complex life cycle, which includes four distinct stages: egg, larva (caterpillar), pupa (chrysalis), and adult. Each stage has specific adaptations and behaviors that contribute to its overall survival. For instance, the adult butterfly has specialized wings that enable it to fly and search for food sources.

Additionally, the monarch butterfly is part of a more complex system known as the ecosystem. Ecosystems are comprised of living organisms, such as plants, animals, and microorganisms, as well as their non-living environment, including the soil, water, and air. Monarch butterflies play a crucial role within this system as pollinators. While searching for nectar, they inadvertently transfer pollen from one flower to another, aiding in plant reproduction.

Moreover, monarch butterflies are part of a larger population and community. They are social insects that migrate in large numbers between different regions. This behavior is influenced by environmental factors such as temperature and availability of food. The migration of monarch butterflies is a remarkable example of how individuals come together to form a collective system.

In summary, a monarch butterfly can be described as a living system that is one part of a more complex system. Its life cycle, ecological role as a pollinator, and participation in migration all contribute to its integration within the larger ecosystem. Understanding the interconnectedness of living systems is crucial in appreciating the diversity and functionality of the natural world.

Know more about monarch butterfly here :

brainly.com/question/11287545

#SPJ8

Which widely used energy sources are nonrenewable and also a source of greenhouse gas emissions?.

Answers

Fossil fuels are energy sources which are nonrenewable and also a source of greenhouse gas emissions

What are Non-Renewable energy ?

Coal, natural gas, oil, and nuclear energy are examples of nonrenewable energy sources. Since we currently rely on these resources to meet the majority of our energy needs, once they are depleted, they cannot be replaced, which poses a serious issue for humanity.

Burning fossil fuels for transportation, electricity, and heating accounts for the majority of greenhouse gas emissions caused by human activity in the United States.

Wind and solar energy are readily available, emit little to no greenhouse gases, and are typically less expensive than coal, oil, or gas.

Learn more about Non- Renewable energy here:

https://brainly.com/question/23606774

#SPJ4

Answer:

Explanation ty so much for likeing and for the 5 stars

Other Questions
The manager of Jerrys Barbershop recently asked 15 customers to punch in a time card when first arrive at the shop and to punch out right after they paid for their haircut, and used the data on the cards to measure how long (in minutes ) it took Jerry and his barbers to cut hair. He also recorded the amount of money spent by each of the 15 customers as well as the customers stage of life (Child, Teen, or Adult).Identify the population in the above scenario. (2 pts.) Identify the variables and their units (if any). (6 pts.)Variable 1: Unit:Variable 2: Unit:Variable 3: Unit: Helppppppppppppppppppp The goal of this exercise is to challenge your knowledge of the three forms of organizational justice. Listed below are questions that an employee might ask. Select the form of organization justice that each question pertains to. If a question does not pertain to a form of organizational justice, select "Does not apply." 1. How fair is the salary I received this year? Distributive justice Read the following paragraph from the section "The Election That Settled Many Ideas."Thomas Jefferson and Alexander Hamilton had different ideas about how America should be. This was settled in the election of 1800, Gutzman says. Jefferson won this election to be a president over John Adams. Hamilton was in Adams' party, the Federalists.Which word could replace "settled" and NOT change the meaning of the sentence? Saba is researching an essay about the effects of laws banning texting while driving. Which research question could Saba ask that has the best connection to her topic? How old are most people who text while driving? How many texts do most people send each day? How have laws banning texting and driving affected accident rates? How does texting and driving help people communicate?. Some people say that city squirrels are more aggressive than squirrels in the countryside. In the city, squirrels come right up to people to take food from their hands, for example. In the country, squirrels are more likely to run away from people. How could you evaluate the claim that squirrels level of aggressiveness is:(1) different in the city from the country, and (2) inherited, not learned. Column Command is present in Home Tab. (1 Point) True False Alexander died shortly after he had conquered the Achaemenid empire, OA. but the Parthians a decade later took over most of his realm. B. but the Romans a decade later took over most of his realm. C. after which his realm was divided among his generals. D. yet his empire lasted for over four centuries Please someone help Write a while loop that divides userNumber by 9, assigns userNumber with the quotient, and outputs the updated userNumber, followed by a newline. The loop iterates until userNumber is less than or equal to 0. please answer asap ty ty An item has a listed price of $95. If the sales tax rate is 5%, how much is the sales tax (in dollars)? write an equation that goes through (4,3) and is parallel to 2y+8x=20 Aquatic biomes can be distinguished by chemical characteristics such as dissolved oxygen content and salinity and by physical characteristics such as water flow.Which five of the following statements about aquatic biomes are true?A freshwater organism permanently attached to the substrate would be unlikely to survive and reproduce in an estuary.Tropical coral reefs generally exist in relatively shallow areas of the ocean.Temperature drives water movement in some lakes.Wetlands have slow water movement or no water movement and no turnover.Estuaries are very productive and are used as breeding grounds by many species of fish. joint commission standards require that a complete history and physical be documented on the health records of operative patients. determine if this carries a time requirement? Please help me figure this out!!Write "four hundred dollars and seventy-two cents" as a fraction (and then reduce) antidilutive securities are excluded from the calculation of eps because they would multiple choice question. not effect eps. decrease eps. increase eps. The gym has a ratio of 7 basketballs for every 6 soccer balls. There are 24 soccer balls. How many basketballs are in the gym? The numeral preceding 100000 base 2 which of the following is true? a. metrics should not be allowed to change as the project progresses. b. good metrics can provide precise predictions of performance rather than a close estimate. c. metrics do not provide any real value unless they can be measured. d. all of above are true.