Answer for you
recall what you have learned about continental drift and plate tectonics. sort the information into the correct categories.
pangaea broke and spread apart.
landforms result from moving plates lithosphere is made of large pieces.
plates move and interact.
continents were once one landmass.

Answers

Answer 1

The correct order is:

Continental Drift:

-Pangaea broke and spread apart

-continents were once one land mass

Plate Tectonics

-Landforms result from moving plates

-plates move and interact

-Lithosphere is made of large pieces

One of the earliest hypotheses put up by geologists for how continents could migrate through time is called continental drift. Gondwana, an early "supercontinent," is seen on this map. It subsequently dispersed to become the continents we see today. Similar creature fossils discovered on wildly dissimilar continents supported the ground-breaking notion of continental drift.

Learn more about continental drift at

https://brainly.com/question/29364490?referrer=searchResults

#SPJ4


Related Questions

Most of a cells proteins are broken down by which organelles?.

Answers

Answer: Lysosomes

Explanation:

Lysosomes have 3 functions that help the cell, they break down excess or worn-out cell parts. They destroy invading viruses and bacteria. , lysosomes can also perform a "self-destruct" in a process called programmed cell death, or apoptosis whenever the cell is damaged beyond repair.

Hope This Helps :)

Can you help me math these ASAP!

Can you help me math these ASAP!

Answers

The matching of each pattern of inheritance to the correct description of phenotypic expression is as follows:

Only homozygous recessive individuals express this phenotype. Males and females express the phenotypes equally: Autosomal recessive trait. Homozygous dominant and heterozygous individuals express this phenotype. Males and females express the phenotypes equally: Autosomal dominant trait. Males with one recessive allele and females with two recessive alleles express this phenotype: Sex-linked recessive trait. Only heterozygotes express this phenotype, but Males and females express the phenotypes equally: Autosomal incomplete dominant traits. Males with one dominant allele and females with two dominant alleles express this phenotype: Sex-linked dominant trait.

What is Inheritance?

Inheritance may be characterized as a type of process through which characters are significantly transferred from one generation to the next generation. It is also known as heredity.

According to the context of this question, autosomal dominant traits typically pass from one parent to their offspring. Autosomal recessive traits pass from both parents onto their offspring.

Sex-linked Dominant inheritance takes place when an abnormal gene from one parent causes disease, even though the matching gene from the other parent is normal. The abnormal gene dominates. But in recessive inheritance, both matching genes must be abnormal to cause disease.

Therefore, the matching of each pattern of inheritance to the correct description of phenotypic expression is well described above.

To learn more about Dominant and recessive traits, refer to the link:

https://brainly.com/question/20639307

#SPJ1

What is generally the site of cellular respiration?

Answers

The site of cellular respiration is generally the mitochondria.

What is creatine called

Answers

Answer:

there are lots of names

Explanation:

different brand names: amidinosarcosine, creatine citrate, creatine monohydrate, creatine phosphate, and N-amidinosarcosine

Answer: Your welcome!

Explanation:

Creatine is an amino acid derivative that is found naturally in the body and is used by athletes to increase muscle mass and strength. It is also known as creatine monohydrate and is one of the most popular and widely used supplements in the health and fitness industry.

A lab tech is analyzing water samples and notices that one of her samples is more green. What does this tell her about the sample?

It absorbs light in the red frequency range.
It contains atoms with the same vibrational frequency as the red light waves.
It contains atoms with the same vibrational frequency as the green light waves.
It reflects light in the green frequency range.

Answers

Answer:

It reflects light in the green frequency range.

What is responsible for the unusual ecosystem of the Ethiopian Highlands? (Select all that apply.)

Answers

The correct answer is:

C) The Highlands experience large amounts of average yearly rainfall.D) The Highlands formed by uplifting volcanic activity.

The unusual ecosystem of the Ethiopian Highlands is primarily influenced by two factors. Firstly, the Highlands experience large amounts of average yearly rainfall. This high rainfall creates a unique environment that supports diverse vegetation and wildlife, including the presence of cloud forests and endemic species. Secondly, the Highlands formed through uplifting volcanic activity, which shaped the topography of the region and contributed to the formation of high plateaus and deep valleys. These geological processes, combined with the rainfall patterns, have contributed to the formation of a distinct and diverse ecosystem in the Ethiopian Highlands.

To know more about ecosystem

brainly.com/question/31459119

#SPJ11

The complete question is:

What is responsible for the unusual ecosystem of the Ethiopian Highlands? (Select all that apply.)

A) The Highlands consist of constantly erupting volcanoes.

B) The Highlands experience small amounts of average yearly rainfall.

C) The Highlands experience large amounts of average yearly rainfall.

D) The Highlands formed by uplifting volcanic activity.

What are the good fats for your brain?
O the glycemic fats
O the omega fats
O low cholesterol
O high cholesterol

Answers

Answer:

B

Explanation: The omega fats, I hope it helps

What are the 3 stages of transcription?

Answers

Transcription is the process by which genetic information encoded in DNA is copied into RNA. There are three main stages of transcription: initiation, elongation, and termination.

During initiation, RNA polymerase, the enzyme responsible for RNA synthesis, binds to the DNA at a specific site called the promoter. The DNA then unwinds to expose a single strand, which serves as the template for RNA synthesis. In the elongation phase, RNA polymerase moves along the DNA template strand, adding nucleotides to the growing RNA molecule according to the complementary base-pairing rules. Finally, during termination, RNA polymerase reaches a specific sequence on the DNA template called the terminator, which signals the end of transcription. The RNA molecule is then released, and RNA polymerase dissociates from the DNA.

To learn more about Transcription refer to:

brainly.com/question/8926797

#SPJ4

if someone asks you questions about a category a infectious substance that you are packaging for shipment, it is acceptable to answer the questions if...
T
F

Answers

If someone asks you questions about a category A infectious substance that you are packaging for shipment, it is acceptable to answer the questions if you have been properly trained and are knowledgeable about the regulations and requirements for packaging and transporting dangerous goods.

However, it is important to be cautious about sharing information that could compromise the safety or security of the shipment, such as specific details about the contents or packaging.

it is also important to follow any company policies or protocols for communication with outside parties regarding hazardous materials. Overall, transparency and open communication can be helpful in ensuring safe and compliant transport of dangerous goods.

To know more about open communication click on below link:

https://brainly.com/question/28466024#

#SPJ11

organic foods have proven to be nutritionally superior to conventionally grown foods.

Answers

"Organic foods have been shown to be nutritionally superior to foods cultivated conventionally."

The statement is true.

Studies show that numerous nutrients are slightly to moderately increased in organic foods. Certain antioxidants and flavonoids, which have antioxidant characteristics, may be present in higher concentrations in organic vegetables.

Many have maintained that organic foods are better for our body than non-organic, or "conventional" meals, which has led to a long-running controversy about them. The distinctions between these two possibilities, nevertheless, are more nuanced than they initially appear.

Foods that are organic are frequently more fresh than those that are conventional, especially if you get them from a local produce stand or farmer's market.

To learn more about Organic foods, refer

https://brainly.com/question/13528932

#SPJ4

How is a phylogenetic tree similar to a dichotomous key.

Answers

Answer: Phylogenetic trees are similar to the dichotomous keys because they used for identification and are artificial.

Answer:

Both focus on illustrating taxonomic relationships between organisms.

Explanation:

this is the correct answer

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)

Answers

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

Exercise 1:

DNA    ATACGAAATCGCGATCGCGGCGATTCGG mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G- Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

Exercise 2:

DNA    TTTACGGCCATCAGGCAATACTGG mRNA    AAAUGCCGGUAGUCCGUUAUGACC CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr

An allele whose trait is masked (weaker) in the presence of a stronger allele

Answers

Answer:

There are 2 alleles, a recessive allele and a dominant allele. The weaker allele is the recessive allele.

Recessive - is weaker dominant is more dominant

Two lizards with slightly different coloring exist within the same ecosystem. although they look almost alike, they are different species because:____.a. they behave differentlyb. they have different characteristics c. they cannot reproduce with one anotherd. they exist within the same ecosystem

Answers

Answer: C. they cannot reproduce with one another.

Explanation:

We can see two lizards of different species in the same ecosystem because they cannot reproduce with one another and that's why they can easily live in the same ecosystem.This is because different species are unable to interbreed and produce healthy offspring. This is because of the mechanism of reproductive isolation, it's like a natural barrier that does not allow them to reproduce. We see a variety of lizards in the same place because of this and they live freely.

Term of : 5th day in development of the conceptus. process in which the blastocyst arrives in the uterine cavity where it floats for a day or two before 'implanting' in the soft, blood-rich uterine lining, which has spent the past 3 weeks preparing for its arrival

Answers

A developing embryo that is travelling through a uterus as a blastocyst undergoes a procedure called implantation in which it contacts the uterine wall and remains attached to it until birth.

As the blastocyst develops, the uterine lining (endometrium) undergoes numerous internal alterations to get ready for the attachment. The embryo will slough off during menstruation if these alterations are not made; otherwise, implantation will not take place.

Although not all animals have it, such implantation is a characteristic of mammals. Additionally, among the mammals that display implantation, the processes in the mammals in which the females have menstrual cycles and those in which the females have estrous cycles differ in a number of important ways. Women of all primate species, including humans, experience menstruation, which results in identical implantation procedures.

To know more about developing embryo please check the following link

https://brainly.com/question/30707550

#SPJ4

Can you explain why DNA must be replicated before mitosis and the role of helicase in DNA replication

Answers

Answer:

1. dna needs to be replicated before mitosis so that the parent cell has the same amount of genetic material as the parent cell once it has split.

2. helicase is an enzyme that is so dna can unwind.

Explanation:

the explanation is in the answer.

I hope this helps!

Answer:

DNA must be replicated before mitosis so that both identical daughter cells contain the same amount of genetic material as the parent cell once it has split in two. Helicase is an enzyme necessary at the initiation of DNA replication to unwind/unzip the DNA so that this process may begin.

placental mammals give birth to more fully developed offspring than marsupial mammals and therefore have a greater chance of offspring survival. this helps to explain why placental mammals from north america displaced many native south american marsupial mammals when a land bridge formed between the two continents.

Answers

It is true that placental mammals give birth to more fully developed offspring than marsupial mammals and therefore have a greater chance of offspring survival. This helps to explain why placental mammals from North America displaced many native South American marsupial mammals when a land bridge formed between the two continents.

Therian mammals called placental mammals have developing placentas during pregnancy. The foetus is fed by the placenta as it develops inside the mother's uterus. Mammals with placenta give birth to children that are generally mature and large. Mammals that carry babies are the majority.

Hence, placental mammals give birth to more fully developed offspring than marsupial mammals and therefore have a greater chance of offspring survival.

To know more about Mammals.

https://brainly.com/question/15326492

#SPJ4

2. Which statement reflects a way in which asexual reproduction is beneficial?
A. It results in genetic variation.
Matching
B. It requires a lot of time and energy.
C. Organisms can reproduce without a mate.

2. Which statement reflects a way in which asexual reproduction is beneficial?A. It results in genetic

Answers

Answer: it will be answer c

Explanation: because it says organisms not human. There are a lot of them could reproduce without mate

please help
PROJECT: RESEARCH AND LEARN: PLANT REPRODUCTION Project Overview For this assignment, you will need to select two specific plants. One must reproduce sexually and the other asexually. Instructions You will describe the plant and the specifics of how they reproduce. Your description must include a step-by-step explanation. Your paper should be approximately 250 words in length.

Answers

Answer:

Step 1: Pollination

In general, male gametes are contained in pollen, which is carried by wind, water, or wildlife (both insects and animals) to reach female gametes. The pollen is deposited on a plant's stigma, which is part of the pistil (the elongated part of a flower extending from the ovary). This process is called pollination.

Step 2: Germination

Within a few minutes, pollen tubes begin growing, or germinating, toward the egg cell. These tubes will provide a path for the sperm carried in the pollen to reach the egg.

Step 3: Penetration of the Ovule

The pollen tubes penetrate the ovule, which contains the female gametes.

Step 4: Fertilization

Sperm travel down the pollen tubes and fertilize an egg. Most angiosperms undergo double fertilization, where both an egg and the polar nuclei in the embryonic sac are fertilized.

Explanation:

^^^^^^^^

Please help, it's a test question!!!

Describe at least two advantages and at least two disadvantages of using embryonic stem cells to repair damaged tissue due to injury or disease. Be sure to use a topic sentence and conclude with a summary

Answers

Because embryonic stem cells are pluripotent stem cells, they can differentiate into any kind of body cell or more stem cells.

Disadvantages of using embryonic stem cells include possibility of development of teratocarcinomas , and chances of rejection by immune system.Advantages of embryonic stem cells include that they can develop into different germ layers and easy collection.

To learn more about cells click here:

https://brainly.com/question/14957605

#SPJ4

Consider the following two statements about succession.
Student 1:
Matthew - As succession begins, communities tend to be dominated by mostly K-selected species. As succession continues, r-selected species tend to compete better and therefore become more and more common.
Student 2:
Iman - As succession begins, communities tend to be dominated by mostly r-selected species. As succession continues, K-selected species tend to compete better and therefore become more and more common.
Which student is correct?
a. Provide a rationale for your answer (2 marks)
b. Provide a specific example of succession which includes at least one example of an r-selected and one example of a K-selected species. (1 mark)
Note - No marks are earned by simply agreeing with either Matthew or Iman

Answers

The correct answer is student 2

if the planets rotation stopped what is 1 thing that would most likely occur

Answers

Answer:

If the planet stopped suddenly, everything on the surface would be destroyed, as the atmosphere, oceans and anything not nailed down kept spinning.

Explanation:

I hope this helps :)

Which of the following is NOT a true statement?*
1 point
Two or more atoms held together with bonds make up a molecule.
Mixtures can be made of two elements, two compounds or an element & a compound.
At least two different types of atoms are required to make a compound.
Pure substances are made of only one type of atom.

Answers

Answer: Two or more atoms held together with bonds make up a molecule.

Explanation:

Two or more atoms held together with bonds make up a molecule. Thus option a is not a true statement.

What is covalent bond?

A covalent bond is defined as  a chemical bond that includes the sharing of electron pair between atoms.

The pair of electrons are know as bonding pairs and the stable balance of attractive and repulsive forces between atoms.

The properties of covalent bond are mentioned below:

The covalent compounds have low melting points and boiling points.

The covalent compounds do not contain electricity.

The covalent compounds are  having lower enthalpies of vaporization and fusion.

The covalent compounds are easily catches fire and are more flammable than ionic compounds.

The covalent compounds are very soft and flexible.

The physical properties of covalent compounds are that they have lower melting points and electrical conductivity.

Therefore, two or more atoms held together with bonds make up a molecule. Thus option a is not a true statement.

Learn more about covalent bond here:

https://brainly.com/question/19382448

#SPJ2

Which coordinates best estimate the location of Woonsocket, SD?

Answers

Answer:

Woonsocket is located at 44°03′10″N 98°16′25″W.

Area code(s): 605

Country: United States

How does negative feedback mechanism work in osmoregulation

Answers

Answer:

Osmoregulation is an example of a negative feedback, homeostatic control system. This system detects changes in the salinity of the water Chinook salmon live in, working to keep the body water concentration constant.

Explanation:

Lara has four samples of substances:


Sample A: 5 g of salt

Sample B: 8 g of sand

Sample C: 8 g of sugar

Sample D: 5 g of sugar


Which of the following samples have the same solubility in water?


Sample A and Sample C


Sample A and Sample D


Sample C and Sample B


Sample C and Sample D



I think it is: Sample A and Sample D. Hope this helps ^^

Answers

I think you are right

Explanation:

Sample A and Sample D

Which gases are found in
the atmospheres of the gas giants?
• A. Carbon dioxide and hydrogen

B. Carbon dioxide and helium

C. Hydrogren and helium
• D. Nitrogen and oxygen
E. Hydrogen and nitrogen

Answers

Answer:

C

Explanation:

Answer:

Hydrogen and helium

Explanation:

Why is fuel burning the worst option for a source of energy?

Answers

Answer: When fossil fuels are burned, they release large amounts of carbon dioxide, a greenhouse gas, into the air. As a result of greenhouse gases, heat is trapped in our atmosphere, resulting in global warming.

Explanation:

A student using a compound light microscope is observing cells undergoing mitotic cell division. If the cells are from a bean plant, which process could the student observe? A. The formation of a cell plate between two new cells B. The replication of centrioles C. A pinching-in of the cell membrane to form two cells D. The pairing of homologous chromosomes

Answers

The student using a compound light microscope to observe cells from a bean plant undergoing mitotic cell division could observe the process A. The formation of a cell plate between two new cells. This is because bean plants are part of the plant kingdom, and in plant cells, a cell plate is formed during cytokinesis to separate the two new cells.


If a student is observing cells undergoing mitotic cell division using a compound light microscope, they could observe several processes depending on the type of cell they are observing. In this case, the cells are from a bean plant. Therefore, the student could observe the formation of a cell plate between two new cells.


During mitosis in plant cells, the spindle fibers elongate and push the two sets of chromosomes towards opposite poles of the cell. As the spindle fibers continue to elongate, they deposit vesicles containing cell wall materials at the center of the cell. These vesicles fuse together to form a new cell wall, which is called the cell plate. The cell plate grows outward until it reaches the old cell wall, separating the two new cells. The pairing of homologous chromosomes is a process that occurs during the previous phase of the cell cycle called meiosis.

To know more about microscope visit :-

https://brainly.com/question/18661784

#SPJ11

Explain why increasing extracellular k+ reduces the net diffusion of k+ out of the neuron.

Answers

Less potassium diffuses out of the neuron as a result of a steeper concentration gradient when extracellular potassium is increased.

K+ leak channels allow K+ ions to leave the cell easily in accordance with the K+ concentration gradient produced by pumps. Theoretically, if there was a greater concentration of K+ outside the cell, these channels would permit K+ to enter. The potassium leak channel is one of the crucial components that maintains the stability of the membrane potential in animal cells. A membrane potential is produced by the difference in electrical charge on either side of a membrane. Because of the sodium-potassium ATPase's creation of a concentration gradient where potassium is more concentrated inside the cell than outside, potassium leak channels frequently allow potassium ions to exit the cell.

Learn more about K+ leak from

brainly.com/question/28903635

#SPJ4

Other Questions
Tar in cigarettes disrupts a process in the upper respiratory tract called the. What is the coefficient of y in the expression x+4y+3 choose the correct answer.bacteria cells exist in .................. basic shapes.A . 4B . 6C . 3D . 7who give correct answers i mark as barinlist 1/2 + 2/5 + 1/8 = ??? List and describe the four types of marine sediments. Burning fossil fuel has which effect in the carbon cycle? XYZ company is looking for a 4-months term source of $800,000 to supplement working capital. Which source below should the company choose? The bank A accepts loans at annual nominal rate of interest of 15% a year. The bank B accepts loans at discount interest rate of 14% a year. The bank C accepts a loan with interest rate of 10% per year and deposits rate at 12% why does he wish someone lived?...... He wishes someone live/lived......which one is correct live or lived _____ resources are resources that cannot be replenished within a lifetime.Question 1 options:NonrenewableRenewableLivingEndangered Which statement is true when calculating the internal rate of return; The required rate of return is needed. The initial investment is not needed The internal rate of return is needed. The required rate of return is not needed I forgot how to find the range of values of x and I will be very much appreciated if I could get a step by step clear solution to get the answers! what do you think happens to the levels of co2 in exhaled air as breathing rate increases? Social darwinists would be most likely to encourage government leaders to pass laws to regulate business. institute laissez-faire policies. establish a minimum wage. encourage immigration. True or False - Temperatures in the desert did not fluctuate (change) much from day to night Constructing a histogram requires dividing the range of the data into class intervals or bins, so it does not preserve each individual observation in the sample. as a firm progresses through the introduction life-cycle stage, what type of flexible account will it be more likely to use to balance the balance sheet? The DNA helicase animation shows the bacteriophage T7 helicase unwinding DNA. Which of the following are critical components of the helicase mechanism of action necessary to unwind DNA?Choose one or more:A.binding of four helicase subunits to the double-stranded DNAB.dissociation of the helicase subunitsC.ATP binding and hydrolysisD.oscillating loops pulling the single-stranded DNA through a central holeE.conformational changes of subunits What is the empirical formula for C2H4S2? What was the real reason for the Falklands War? One problem for natural rights theory is that not everyone agrees on what human nature requires.