A type of genetic inheritance in which two phenotypes are seen together on the offspring is known as:.

Answers

Answer 1

Answer:

Codominance


Reason:

A codominance connection exists between two copies of a gene. Individuals inherit one copy of a gene, known as alleles, of each parent. If they are different , the allele that is dominant  will typically be displayed, while the influence of the other allele, the recessive, will be concealed.

Answer 2

Answer:

Codominance

A codominance connection exists between two copies of a gene. Individuals inherit one copy of a gene, known as alleles, of each parent. If they are different , the allele that is dominant  will typically be displayed, while the influence of the other allele, the recessive, will be concealed.

Explanation:

A codominance relationship exists between two gene copies. Individuals may develop one copy of both parent's genes., known as alleles. If they vary, the dominant allele will usually be visible, while the effect of the recessive allele will be hidden.


Related Questions


In addition to how much force Earth exerts on the object, which features of an object affect its weight?
mass and location of the object
shape and location of the object
location of the object and how much energy the object has
mass of the object and how much energy the object has

Answers

Answer: A (I got it right)

In addition to how much force Earth exerts on the object, which features of an object affect its weight?

mass and location of the object

shape and location of the object

location of the object and how much energy the object has

mass of the object and how much energy the object has

Explanation:

Answer: A

Explanation:

hope this helps!

In pet rabbits, brown coat color is recessive to black coat color. If a black-coated rabbit has offspring with a brown-coated rabbit, what is the probability that their offspring will have black coats? A) 0% B) 25% C) 50%D) 75% E) 100%

Answers

Therefore, the probability that their offspring will have black coats is 100%, option E.

If brown coat color in pet rabbits is recessive to black coat color, it means that a rabbit must inherit two copies of the brown coat color gene (one from each parent) to express the brown coat color phenotype.

Since the black-coated rabbit is homozygous dominant (having two copies of the black coat color gene), all its offspring will receive one copy of the black coat color gene from the black-coated parent.

When a black-coated rabbit (genotype BB) is crossed with a brown-coated rabbit (genotype bb), all the offspring will receive one copy of the black coat color gene from the black-coated parent (B), and one copy of the brown coat color gene from the brown-coated parent (b).

The genotype of the offspring will be Bb, meaning they will carry one copy of the black coat color gene and one copy of the brown coat color gene. However, since black coat color is dominant, the offspring will have black coats, even though they carry the brown coat color gene.

Therefore, the probability that their offspring will have black coats is 100%, option E.

To know more about homozygous refer  here

brainly.com/question/30703457#

#SPJ11

38. an acid elution stain was made using a 1-hour post-delivery maternal blood sample. out of 2,000 cells that were counted, 30 of them appeared to contain fetal hemoglobin. it is the policy of the medical center to add 1 vial of rh immune globulin to the calculated dose when the estimated volume of the hemorrhage exceeds 20 ml of whole blood. calculate the number of vials of rh immune globulin that would be indicated under these circumstances.

Answers

Rh immune globulin, also known as Rho(D) immune globulin or anti-D immunoglobulin, is a medication used to prevent sensitization to the Rh factor in individuals who are Rh-negative. The number of vials of Rh immune globulin indicated would be 1.

In this scenario, an acid elution stain was performed on a 1-hour post-delivery maternal blood sample. Out of the 2,000 cells that were counted, 30 of them appeared to contain fetal hemoglobin. This finding suggests that there may have been fetal-maternal hemorrhage during delivery.

According to the medical center's policy, the administration of Rh immune globulin is indicated when the estimated volume of the hemorrhage exceeds 20 ml of whole blood. However, the given information does not provide the volume of the hemorrhage, so we cannot determine if it exceeds the threshold. Therefore, based solely on the information provided, we can conclude that 1 vial of Rh immune globulin would be indicated.

To know more about immune here

https://brainly.com/question/823997

#SPJ4

Describe the roles of the lymphatic system​

Answers

Answer:

Your lymphatic system, part of your immune system, has many functions. They include protecting your body from illness-causing invaders, maintaining body fluid levels, absorbing digestive tract fats and removing cellular waste. Blockages, diseases or infections can affect your lymphatic system's function.

Explanation:

Answer:

Your lymphatic system, part of your immune system, has many functions. They include protecting your body from illness-causing invaders, maintaining body fluid levels, absorbing digestive tract fats and removing cellular waste. Blockages, diseases or infections can affect your lymphatic system's function.Feb 23, 2020

The lymphatic system is our body's 'sewerage system'. It maintains fluid levels in our body tissues by removing all fluids that leak out of our blood vessels. The lymphatic system is important for the optimal functioning of our general and specific immune responses.Mar 31, 2012

Functions of the Lymphatic System

The removal of excess fluids from body tissues. ...

Absorption of fatty acids and subsequent transport of fat, chyle, to the circulatory system.

Production of immune cells (such as lymphocytes, monocytes, and antibody producing cells called plasma cells).

What are the functions of the Lymphatic System? To transport fluids back to blood and act as the bodies defense and resistance to disease.

use what you need

Explanation:

You have been appointed a the United State repreentative to an international conference that will replace the Kyoto Protocol. All nation recognize that the Kyoto Protocol wa not fully effective, and mot are committed to creating a tronger agreement. What type of agreement will you try to hape? Decribe at leat 3 component you would upport and at leat one you would oppoe

Answers

A global accord called the Kyoto Protocol aims to regulate greenhouse gas emissions. The Kyoto Protocol is mandatory, not optional, in contrast to the UNFCCC.

Nations that ratified the agreement pledged to lower greenhouse gas emissions from 1990 levels. After being ratified by 127 countries, including Russia, the pact came into force in 2005.

The Kyoto Protocol was not ratified by the United States. Because the Kyoto Protocol only obliged industrialized countries to reduce emissions, not developing countries like China and India, several American officials criticized the agreement as unfair.

The various standards, according to proponents of the Kyoto Protocol, are justified because the current greenhouse gas problem was caused by industrialized nations. Consequently, developed countries, such as the United States, should  lead the charge to resolve it.

Learn more about " kyoto protocol " to visit here;

https://brainly.com/question/8668856

#SPJ4

Identify the form carbón takes in the biosphere, hydrosphere geosphere and atmosphere

Answers

Biosphere: stored in plants and trees
Hydrosphere: stored in organic compounds trapped in living organisms and in the soil
Geosphere: stored in rocks, fossil fuels, and magma
Atmosphere: stored in rocks and sediments. Also the deep ocean

What change caused the rate of population growth to increase around point C?

What change caused the rate of population growth to increase around point C?

Answers

Answer:

point c

Explanation:

Select the correct answer from each drop-down menu. The salamander is an amphibian, so it has a as it grows and develops. The adult form is different from the larva because the adult​

Select the correct answer from each drop-down menu. The salamander is an amphibian, so it has a as it

Answers

Answer:

The salamander is an amphibian, so it has metamorphis as it grows and develops. The adult form is different from the larva because the adult​ breathes through lungs.

hope this helps! :D

Answer:

The options are not given, here are the options  for drop down.

Question 1 options-A) metamorphosis B) pupae stage C)simple life cycle

Question 2 options- A)breathes through lungs B) forms a pupa C) lives completely underwater

The correct answers are A A- Metamorphosis; breathes through lungs

As an amphibian, the salamander undergoes metamorphosis as it grows and develops. The adult is distinguished from the larva by the fact that it breathes through its lungs.

Explanation:

Salamander larvae breathe through their gills, whereas adults breathe through their lungs. The larvae stage develops 30 days after hatching and can either metamorphose into an adult (60 days after hatching) or stay as larvae until they reach maturity.Salamanders go through a transformation process that affects their reproductive abilities. They have a larvae stage that breathes through gills because the larvae are similar to fish and have gills for breathing, but the adults breathe through lungs. The larvae stage develops 30 days after hatching, while the adult stage develops 60 days after hatching.Hence, the correct answer is: The salamander is an amphibian, so it has a Metamorphosis as it grows and develops. The adult form is different from the larva because the adult​ breathes through lungs.

To Know more about the salamander refer link:https://brainly.com/question/2590720?referrer=searchResults

Which of the following is a characteristic of a prokaryotic cell?

Answers

Prokaryotic cells do not have a differentiated nucleus.

What are prokaryotic cells?

Prokaryotic cells are known because their genetic material, that is, their DNA, is located in the cytoplasm and is not separated from it. It does not have a compartmentalized nucleus into which its DNA separates. Something different from eukaryotic cells in which we find their compartmentalized organelles and their DNA is enclosed in the nucleus.

Likewise, prokaryotic cells are quite similar to eukaryotic cells in that they also contain a cell membrane, cytoplasm, ribosomes, and prokaryotic compartments. Its cell wall is not so similar to that of eukaryotic cells, but is more similar to that of plant cells, which is a rigid wall as in the cells of the fungi kingdom or algae.

Usually the organisms in which this prokaryotic system is found is in unicellular organisms. Prokaryotic cells are usually bacteria and may have flagella, cilia, or pili attached to their cell walls.

Therefore, we can confirm that prokaryotic cells do not have a differentiated nucleus.

To learn more about prokaryotic cells visit: https://brainly.com/question/18348786

Which of the following is a characteristic of a prokaryotic cell?

A. It does not have a nucleus.

B. It has membrane-bound organelles.

C. It is larger in size than a eukaryotic cell.

D. It is not present in unicellular organisms.

#SPJ1

which of the following can be considered a habitat corridor? select all that apply. canals connecting lakes and rivers an abandoned agricultural field in a suburban area a strip of forest along the banks of a river flowing through a city a patch of forest within a city park a large lake in a city park

Answers

An abandoned agricultural field in a suburban area and a large lake in a city park are not habitat corridors, as they do not connect different habitats for wildlife to move through.

The following options can be considered as habitat corridors:

Canals connecting lakes and rivers

A strip of forest along the banks of a river flowing through a city

A patch of forest within a city park

A habitat corridor is a narrow strip of habitat that connects otherwise fragmented habitats, allowing species to move between them. This movement can help to prevent genetic isolation and improve genetic diversity, which can be important for the long-term survival of populations.

Canals connecting lakes and rivers can provide a habitat corridor for aquatic species to move between different bodies of water. Similarly, a strip of forest along the banks of a river flowing through a city can provide a green corridor for terrestrial species to move along the watercourse. A patch of forest within a city park can also provide a small habitat corridor within an urban area.

An abandoned agricultural field in a suburban area is not typically considered a habitat corridor, as it does not connect different habitats. However, it could potentially be restored or converted into a habitat corridor if it were planted with native vegetation and connected to other nearby habitats.

A large lake in a city park is not typically considered a habitat corridor either, as it is a single habitat rather than a corridor connecting different habitats. However, lakes can still provide important habitat for aquatic species and may support wildlife populations that can move between the lake and other habitats via other corridors.

To know more about habitat corridors

brainly.com/question/29875854

#SPJ4

what is the speed of the wave if the frequency is 4Hz and the wavelength is 2.5m?

Answers

Answer:

32 meeters/ seconds

Explanation:

32 meters or 14 meters , im not sure lol

Does photosynthesis release energy or capture and store energy?

Answers

Answer:

capture and store

Explanation:

through photosynthesis, a plant is gathering energy and storing it and turning it into food

In its excretory role, the urinary system is primarily concerned with the removal of __________ wastes from the body.

Answers

Answer:

Toxic

Explanation:

The body removes toxic waste from your body in order to protect it.

Toxic waste from the body.

Restriction Enzymes and Freezing Oranges Student Activity Sheet
1. Find the AFP sequence in the Flounder DNA. Color the AFP Sequence with one color.
2. Find restriction sites for Hind III on either side of the AFP Sequence. Color it with your second color. Remember they will
have "sticky ends"
3.
Find a Hind Ill restriction site in the Orange tree DNA. Color it with your first color (remember it will have "sticky ends")
4. Cut out the AFP sequence and make a cut in the Orange tree DNA. You would then insert the AFP gene into the orange tree
DNA. This would give the orange tree the gene for AFP.
5. Complete the analysis questions at the bottom.
Pseudopleuronectes americanus (winter flounder) DNA sequence:
CGTATACCTGCCGGCATGCATACATATGCGTCATATGCGCCGGCTACGGTACTCA
GCATATGGACGGCCGTACGTATGTATACGCAGTATACGCGGCCGATGCCATGAGT
Citrus sinensis (orange tree) DNA Sequence:
GGTCAATCGCGTTAAAAGCC GGCTGCGCGTTGACCTCATACGTACGAATGTTGCA
CCAGTTAGCGCAATTTTCGGCCGACGCGCAACTGGAGTATGCATGCTTACAACGT

The APF sequence in the flounder dna is ATGCATACATATGCGTCATATG

Answers

The Hind III restriction site on the left side of the AFP sequence is  said to be : AAGCTT (in the flounder DNA).

The Hind III restriction site on the right side of the AFP sequence is said to be : AAGCTT (in the flounder DNA).The Hind III restriction site in the orange tree DNA is said to be: AAGCTT.

What is the restriction site

An enzyme that cuts DNA at specific recognition sites.

Note tat An overhanging end of a double-stranded DNA molecule that can base-pair with complementary sticky ends of another DNA molecule cut with the same enzyme. AFP-producing orange trees can tolerate cold temperatures better, reducing crop damage and increasing yields for farmers.

Read more about restriction site  here:

https://brainly.com/question/1127662

#SPJ1

When a child begins to get its first teeth, what happens to the microbiota in the oral cavity?
a. The teeth are rapidly colonized by anaerobes, in particular Streptococcus, that are specifically adapted to growth in biofilms in the gingival crevices.
b. The teeth are rapidly colonized by obligate anaerobes, in particular Fusobacterium, that are specifically adapted to growth in biofilms on the surfaces of the teeth.
c. The teeth are rapidly colonized by anaerobes, in particular Streptococcus, that are specifically adapted to growth in biofilms on the surfaces of the teeth.
d. The teeth are rapidly colonized by aerobes, in particular Streptococcus, that are specifically adapted to growth in biofilms on the surfaces of the teeth.

Answers

When a child begins to get its first teeth, the microbiota in the oral cavity changes rapidly. The correct option is C.

The teeth are rapidly colonized by anaerobes, in particular Streptococcus, that are specifically adapted to growth in biofilms on the surfaces of the teeth.

Streptococcus is a genus of bacteria that is commonly found in the human oral cavity, and some species of Streptococcus are adapted to colonize the teeth and form biofilms on their surfaces. As the child's teeth erupt, the newly exposed tooth surfaces provide a surface for the bacteria to attach and colonize.

Streptococcus is able to metabolize sucrose and other carbohydrates to produce lactic acid, which can lead to the demineralization of the tooth enamel and the development of dental caries. Over time, other species of bacteria may also colonize the oral cavity and contribute to the diversity of the oral microbiota.

Therefore the correct option is C.

To know more about microbiota , refer here:

https://brainly.com/question/29602221#

#SPJ11

movement of the chromosomes during anaphase would be most directly affected by a drug that prevents which of the following events?\

Answers

During anaphase, the movement of the chromosomes is most directly affected by a drug that prevents the separation of sister chromatids. This separation is an important step in the process of mitosis, and if the sister chromatids are unable to separate, the chromosomes will not be able to move to opposite ends of the cell.

Anaphase is the stage of mitosis or meiosis that begins when sister chromatids split and move apart to opposite poles of the cell, drawing the chromosomes to opposite poles of the cell along with them. During this process, spindle fibers contract, and the centromeres holding sister chromatids together divide, allowing the chromatids to be drawn away from one another to opposing poles.Chromosomes are pulled toward opposite poles by microtubules during anaphase. When the spindle fibers attach to the centromere, the chromosomes become stable and prepared to be pulled apart. The separation of chromosomes during anaphase will be affected by drugs that impede the breakdown of the connection between sister chromatids. Chromosome separation could be disrupted by an inhibitor of the anaphase-promoting complex (APC).Furthermore, the movement of chromosomes during anaphase would be most directly affected by a drug that prevents the separation of sister chromatids.

Learn more about Anaphase: https://brainly.com/question/14661163

#SPJ11

Which of the following best describes the semiconservative model and the end result
of DNA replication?

When replication is complete you have two identical DNA molecules with two conserved
strands.

When replication is complete you have one DNA molecule that consists of three conserved
strands and one new strand.

When replication is complete you have one DNA molecule that consists of two conserved
strands.

When replication is complete you have two identical DNA molecules, each with one new
strand and one old strand.

Answers

Answer: C

Explanation: When replication is complete you have one DNA molecule that consists of two conserved strands.

What is displacement of metals?

Answers

Search Results
Featured snippet from the web
Displacement reactions. Displacement reactions occur when a metal from the electrochemical series is mixed with the ions of a metal lower down in the electrochemical series. The atoms of the more reactive metal push their electrons on to ions of the less reactive metal. An example can be seen below.
It occurs when a metal from the electrochemical series is mixed with ions of a metal lower down in the electrochemical series.

majority of atp in aerobic respiration is generated thanks to nadph produced during

Answers

Majority of atp in aerobic respiration is generated thanks to nadph produced during the light-dependent reactions of photosynthesis.

NADPH is an electron carrier that donates electrons and protons to the electron transport chain during cellular respiration. This donation drives the production of ATP through the process of oxidative phosphorylation, which occurs in the mitochondria. The energy released by the oxidation of NADPH is used to power the pumping of protons across the inner mitochondrial membrane, creating a proton gradient that drives ATP synthase to generate ATP. Therefore, the NADPH produced during photosynthesis is crucial in powering the production of ATP during aerobic respiration, making it a vital component in maintaining energy balance in cells.

Learn more about ATP here: brainly.com/question/174043

#SPJ4

explain why parents may be fearful or apprehensive about genetic testing.

Answers

They can be wary because they don't want to learn that their child has a condition or because of how much is at stake.

Why is parental apprehension around genetic testing?

Because the findings of genetic testing can expose information about family members besides the test subject, there are times when this causes conflict within a family.

Why is genetic testing opposed by some people?

Some believe that discrimination against people with "poor" genes might result from genetic screening.Second, people worry that genetic testing will force them to base reproductive choices on their child's genetic makeup.

To know more about child visit:

https://brainly.com/question/12598804

#SPJ4

Osmosis does not require an additional input of energy from the cell.
Osmosis is considered to be a type of
active transport
endocytosis
passive transport
exocytosis

Answers

Answer:

Osmosis is considered to be a type of

active transport.

Explanation:

Answer:

passive transport

Explanation:

Osmosis is the process in which water molecules move from a region of higher water potential to a region of lower potential down a water potential gradient across a partially permeable membrane, so little energy is required to carry out this process, thus it is a form or passive transport.

You are examining an organism recently found on Mars and are currently trying to identify one of its neurotransmitters. Biochemical characterization indicates that it is a derivative of the amino acid tyrosine, so you classify the novel neurotransmitter as a(n)

Answers

Answer:

Tyrosine derived neurotransmitters

Explanation:

These neurotransmitters are produced as a result of the conversion of tyrosine when not incorporated into proteins or energy production is converted to catecholamines.

These catecholamines includes dopamine, norepinephrine, and epinephrine.

All these three catecholamines produce various effects in numerous locations in the body acting either as a neurotransmitter or as a hormone

the ovary develops into the?

the ovary develops into the?

Answers

Answer:

Ovules

I hope this helps!

Answer:

fruit

Explanation:

The ovary itself will mature into a fruit, either dry or fleshy, enclosing the seeds

how might it hurt ecosystem stabiility

Answers

how might what hurt ?


please help with “new strands “
will mark brainlist

please help with new strands will mark brainlist

Answers

A always translates to T in DNA
T always translates to A in DNA
C always translates to G in DNA
G always translates to C in DNA
… so the answer to the first strand would be
A
C
G
T
C
… and the answer to the seonnd new strand would be
T
G
C
A
G

The strands compare because they are inverses of each other, notice the original strand of the first DNA is the same as the new strand of the second DNA and vice versa, and because the base pairs (ATCG) always match to their pairs (A-T) (G-C) the new strand of the first DNA will also match the old strand of the second DNA

Hope that helped LMK if you are confused on any bit :)

What is generally the site of cellular respiration?

Answers

The site of cellular respiration is generally the mitochondria.

The items that bind to the active sites of enzymes are called.

Answers

Answer:

Substrates

Explanation:

The molecules that an enzyme works with are called substrates. The substrates bind to a region on the enzyme called the active site. There are two theories explaining the enzyme-substrate interaction. In the lock-and-key model, the active site of an enzyme is precisely shaped to hold specific substrates.

How do all of the parts of this organism work together in order for it to function properly? Explain your answer.

Answers

Answer:

Humans—and other complex multicellular organisms—have systems of organs that work together, carrying out processes that keep us alive.

The body has levels of organization that build on each other. Cells make up tissues, tissues make up organs, and organs make up organ systems.

The function of an organ system depends on the integrated activity of its organs. For instance, digestive system organs cooperate to process food.

The survival of the organism depends on the integrated activity of all the organ systems, often coordinated by the endocrine and nervous systems.

Explanation:

brainliest?

The basic components of the complex human organism is made up of cells. Its level of organization are coordinated with each other to perform specific function.

what are the level of organization ?

The primary chemical level of organization include atoms, ions, and small molecules which are joined to form macromolecules; The macromolecule include larger molecule like amino acid, carbohydrate, fats, nucleic acid where the basic components are carbon, hydrogen and oxygen atoms.

This macromolecule act as biomolecule at cellular level, the cellular level include the smallest unit of living organism, it can be unicellular and multicellular in nature based on complexity of the organism.

The tissue level of organization include a number of cells are gathered together and perform a specific function called tissue like epithelial, connective, muscular tissue.

The organ level include groups of tissues which work together to perform a higher-level function like stomach, heart etc; The organ system include all of the organs involved in doing a vital function, like digestive system, circulatory system,

In this way a complex organism perform their activities.

For more details regarding level of organization , visit:

brainly.com/question/13561100

#SPJ2

among all the data mining methods that we learned in this class, which one(s) do you think is/are useful for business? please give examples.

Answers

Data mining methods play a crucial role in the business world, as they help organizations discover valuable insights from vast amounts of data. Among the various techniques, two particularly useful methods for businesses are clustering and association rule learning.


One of the most common and useful methods is association rule learning, which involves identifying patterns and relationships between different variables or attributes in large datasets. This can help businesses to better understand consumer behavior, market trends, and other key factors that affect their operations and profitability.
Another useful data mining method for businesses is classification, which involves categorizing data into different groups or classes based on specific criteria or features. This can be particularly helpful in areas such as fraud detection, risk assessment, and customer segmentation, where businesses need to identify and target specific groups of customers or transactions.
Finally, clustering is another data mining method that can be useful for businesses, particularly in areas such as customer segmentation and market analysis. This involves grouping similar data points together based on specific criteria or attributes, such as demographics, buying habits, or location.
Overall, the choice of data mining method will depend on the specific needs and goals of the business in question. By using the right combination of data mining techniques, businesses can gain valuable insights into their operations, customers, and markets, and make more informed decisions that drive growth and profitability.
In conclusion, data mining methods such as clustering and association rule learning are essential tools for businesses to gain valuable insights, optimize marketing strategies, and enhance customer satisfaction. By leveraging these techniques, organizations can make data-driven decisions to stay competitive in today's rapidly evolving business landscape.

Learn more about customer segmentation here:

https://brainly.com/question/31855211

#SPJ11

what particle allows an atom to create new substances

Answers

Answer:

An atom makes up everything in the universe

Explanation:

Other Questions
Bellringer 9/15What is humanism? How did it change people's view of the world? Given that a typical excretory system selectively absorbs and secretes materials, what function does filtration serve? Economies of countries with dictatorships do not have healthy financial systems mainly because they lack what? Kyle used 9 as An estimate for 3 1/6 + 5 7/8. He got 9 1/24 for the exact sum. Is his calculated answer reasonable? Explain Who is most often the direct employer of a hotel's line level staff when a management company operates a branded hotel?A) The franchisorB) The hotel's ownerC) The management companyD) The hotel's brand managers Which of the following illustrates that Colonel Lloyd was a fickle and unpredictable master?"They [old Barney and young Barney] never knew when they were safe from punishment. They were frequently whipped when least deserving, and escaped whipping when most deserving it.""I have seen Colonel Lloyd make old Barney, a man between fifty and sixty years of age, uncover his bald head, kneel down upon the cold, damp ground, and receive upon his naked and toil-worn shoulders more than thirty lashes at the time.""He was said to own a thousand slaves, and I think this estimate quite within the truth."all of these What is the area of the figure? kamiya owns a small business that has always put customer service first, even if it meant a loss in profit. kamiya's company is being bought by another firm that has always emphasized profits to the point that some employees are fired if they cost the company profit. what will be the greatest challenge of integrating the two companies? Which answer choice correctly represents 0.4121212?A) 0.412 _B) 0.412 __C) 0.412 ___D)0.412 what is the sum of 9.72 108 and 1.93 107a. 9.913 107b. 9.913 108c. 1.165 108d. 1.165 109 What accounting book is used to capture changes to the trial balance the sum of kinetic and potential energies of a system of objects is conserved when only conservative forces Scientists often work together in teams to solve problems. In 2009, an influenza virus emerged from pigs that went on to infect an estimated 24 percent of the world human population. How could biologists from a variety of fields contribute to studying this widespread disease and developing a treatment, prevention, or cure? the melting point of a mineral generally _____ with increasing pressure (or depth). What is an example normalcy in the lottery? shvadchak v.v., klymchenko a.s., de rocquigny h., mely y., sensing peptide - oligonucleotide interactions by a two-color fluorescence label: application to the hiv-1 nucleocapsid protein, nucl. acids res., 2009, 37, p. e25. Find the value of each variable. What should we do for healthy? Listen Why are gains/losses added back to (or deducted from) the cash from operations section of a cash flow statement? 1) They often represent insignificant amounts that don't affect end results. 2) They are an accounting recognition of a gain or loss and don't affect cash flow. 3) Cash flows after the add back (or deduction) look a lot better. 4) It is established practice to perform this step as part of the process of creating a cash flow statement If I were to post your sales goals on the white-board at work, what strategy for fostering goal commitment would I be using?