2. A first-order reaction is 38. 5% complete in 480 s. A. Calculate the value of the rate constant. B. What is the value of the half-life. C. How long will it take for the reaction to reach 95% completion

Answers

Answer 1

The value of the rate constant is 0.0042 s⁻¹.

The value of the half-life is 302.5 s.

It will take 2851.6 s  for the reaction to reach 95% completion.

A. To calculate the value of the rate constant for a first-order reaction, we can use the equation

ln(A/A₀) = -kt,

where A₀ is the initial concentration, A is the concentration at a given time, k is the rate constant, and t is the time.

Given that the reaction is 38.5% complete in 480 s, we can determine the value of A/A₀ as 0.385. Plugging this value and the time (480 s) into the equation, we have

ln(0.385) = -k * 480 s.

k = -ln(0.385) / 480 s

k = 0.00229 s⁻¹

The rate constant is approximately 0.00229 s⁻¹

B. The half-life of a first-order reaction can be calculated using the equation t₁/₂ = (ln 2) / k, where k is the rate constant. Substituting the value of k obtained in part A (0.0042 s⁻¹) into the equation,

t₁/₂ = ln(2) / 0.00229 s⁻¹

Evaluating this expression gives us:

t₁/₂ = 302.5 s

So, the half-life is approximately 302.5 s

C. To calculate the time required for the reaction to reach 95% completion, we can rearrange the first-order reaction equation as

t = (ln(A/A₀)) / -k.

Substituting the values of

t = ln(0.95) / (-0.00229 s⁻¹)

Calculating this expression gives us:

t = 5424.4 s

The amount of hydrogen required to make 13.78 moles of ethane is roughly 27.56 moles.

To know more about the First-order reaction, here

https://brainly.com/question/31992664

#SPJ4


Related Questions

Why the presence of an acid is necessary for mn4- to function as an oxidising agent

Answers

The presence of an acid is necessary for Mn4- to function as an oxidizing agent.

The presence of an acid is necessary for Mn4- to function as an oxidizing agent. Mn4- is a manganese ion in its highest oxidation state (+7), and it can accept electrons from other substances during a redox reaction. In order for Mn4- to act as an oxidizing agent, it needs to undergo reduction itself by gaining electrons. The acid provides the necessary protons (H+) to balance the charge and enable the reduction of Mn4- to occur. This acidic environment ensures that Mn4- remains stable and allows it to effectively oxidize other substances. Without the presence of an acid, Mn4- would not be able to function as an oxidizing agent.

To know more about oxidizing agent visit:

https://brainly.com/question/29137128

#SPJ11

state two advantages of the environmental method over the chemical method of controlling mosquito ​

Answers

The mosquitoes play an important role which serve as pollinators and as a food source for other wildlife. It is often said that the mosquitoes serve no purpose other than to annoy humans.

What are the environmental methods to control mosquitoes?

The mosquito breeding can be eliminated at home by removing unused plastic substances, old tires, buckets and also by eliminating stagnant water and polluted water.

In order to reduce the population of mosquito naturally, clean our surroundings and home clean, burn the wastes, plastics, etc. Dumping or removing stand water in and around our home is another way to control larvae.

To know more about mosquito, visit;

https://brainly.com/question/7690716

#SPJ1

Determine which elements are A and B for the molecule butane.
A Choose...
B Choose...

Determine which elements are A and B for the molecule butane.A Choose... B Choose...
Determine which elements are A and B for the molecule butane.A Choose... B Choose...

Answers

Answer:

The answer is

A- H

B- C

Explanation:

Answer:

The answer is

A- H

B- C

Explanation:

The second step in the Gram staining procedure involves flooding the slide for one minute with ____
A. a decolorizing agent. B. iodine. C. safranin.

Answers

The second step in the Gram staining procedure involves the flooding of the slide for the one minute is with iodine . The correct option is B. iodine.

There are the four fundamental steps in the Gram stain process , the first is to apply a base color that is the crystal violet. In second step  adding the Gram's iodine as the mordant. In the third step, the Rapid decolorization with the acetone, the ethanol, or the combination of the two and in the four step,  Using the safranin as the counterstain.

Thus, the iodine will be used in the second step in the Gram staining process that involves the flooding in the slide for one minute.

To learn more about gram stain here

https://brainly.com/question/12255227

#SPJ4

What mass of sulfuric acid (H2SO4) is contained in 50.00 mL of a 5.85 M solution? grams

Answers

Answer:

28.69 grams

Explanation:

To find the mass, we first need to find the moles. Once we have the moles, it is easy to use the molar mass of H2SO4 to find its mass.

To find the moles, remember that molarity (M) is equal to the moles divided by the volume (L). The volume HAS TO be converted to liters!

M = moles / V

5.85 M = moles / 0.05 L

moles = 0.2925

Now we know that we have 0.2925 moles of sulfuric acid. The molar mass of sulfuric acid is 98.08 g/mol.

0.2925 moles * (98.08 g / mol) = 28.69 grams

Make sense? If you have any questions, don't hesitate to ask!

Which statement accurately describes
the inner planets

Answers

The inner planets are also called terrestrial planets.

Answer:

The inner planets are also called terrestrial planets.

Explanation:

A bus starts from rest. If the acceleration is 2 m/s², calculate the velocity of the bus affer 2 seconds.​

Answers

2 seconds bc I just read it and I know I’m right 23:33

Which of the following is an empirical formula?A.) P4O10B.) C2H4C.) H2O2D.) N2O

Answers

Answer:

N2O is an empirical formula

Explanation:

A.) P4O10   NO:  Can be reduced to P2O5

B.) C2H4    NO:  Can be reduced to CH2

C.) H2O2     NO:  Can be reduced to H O

D.) N2O     YES, the formula cannot be reduced any further.

Replication, Transcription, and Translation Chart
Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

Which part of this chemical reaction is the Brønsted-Lowry base?

BrO + H2CO3 --> HCO3 + BrOH

BrO
HCO3
H2CO3
BrOH

Answers

The part of the chemical reaction that is the Brønsted-Lowry base is BrO.

BRONSTED-LOWRY BASE:

Bronsted-Lowry definition of a base and acid is as follows:

A base is a substance that accepts a hydrogen ion or proton (H+) An acid is a substance that donates or loses a hydrogen ion or proton (H+).

According to this question, the following chemical reaction is given:

BrO + H2CO3 → HCO3 + BrOH

In the above reaction, BrO is the compound that accepts the hydrogen ion (H+) to become BrOH, hence, BrO is the Bronsted-Lowry base.

Learn more about Bronsted-Lowry base at: https://brainly.com/question/12916250?referrer=searchResults

Acorbic acid or Vitamin C (C6H8O6) i an eential vitamin. It cannot be tored by the body and mut be preent in the diet. What i the molar ma of Vitamin C? Vitamin C are taken a a dietary upplement. If a typical tablet contain 500mg of Vitamin C what amount (mole) and what number of molecule of Vitamin C doe it contain?

Answers

The molar mass of ascorbic acid (C₆H₈O₆) is 176 g/mol. The 0.028 mol (amount ) of Vitamin C tablet contains 1.37 × 10 ²² molecules.

The ratio between the mass and the amount of substance in any sample of a chemical compound is known as the molar mass in chemistry. The molar mass of a substance is a bulk attribute rather than a molecular one.

Molar mass of the ascorbic acid is equal to the sum of the average masses of its constituents -

Molar mass of ascorbic acid (C₆H₈O₆)is -

⇒ 6 × 12 + 8 × 1 + 6 × 16

⇒ 72 + 8 + 96

⇒ 176 g/mol

Mass of 1 Vitamin C tablet is 500mg,

Mass of Vitamin C in 10 Tablets = 0.5 g × 10 = 5 g

Moles of Vitamin C in 10 tablets -

= 5 × (1 mol / 176) = 0.028 mol

Number of molecules = 0.028 mol  ×[ 6.022 × 10²³ / 1 mol ]

⇒ 0.137 × 10 ²³ molecules. 0r 1.37 × 10 ²² molecules

To learn more about number of moles from given link

https://brainly.com/question/1417635

#SPJ4

why is hcl used instead of plain deionized water in p-phenetidine in amide synthesis of acetophenetidin?

Answers

HCl is used instead of plain deionized water in p-phenetidine in amide synthesis of acetophenetidin because HCl's polarity contributes to a reaction driven to the right, it is used for the acid-base reaction rather than water. It protonates the amine group, allowing it to dissolve easily.

What is acid-base reaction ?

An acid-base neutralization reaction is represented as a double-replacement reaction in this traditional representation. For example, the reaction of hydrochloric acid (HCl) with sodium hydroxide (NaOH) solutions yields a solution of sodium chloride (NaCl) and a few extra water molecules.

When acid and base react, they produce salt and water. Water and salt are both neutral, which means that when acid and base react, they neutralize each other. As a result, it is known as a neutralization reaction.

Thus,  HCl's polarity contributes to a reaction driven to the right.

To learn more about an acid-base reaction, follow the link;

https://brainly.com/question/3069273

#SPJ1

3(x - 2) = 5(x + 4)

Answers

Answer:

Uh first of all this is algebra but I'll answer this

First distribute the three and 5 (Multiply them by both terms inside parenthesis.

3x-6=5x+20

Then add like terms

8x=14

Divide 8 by 8 and 8 by 14

x = 14/8

Explanation:

Answer:

The answer is \(x = -13\) .

Explanation:

Solve the equation:

\(3(x -2) = 5(x + 4)\)

Use Distributive Property:

\(3(x -2) = 5(x + 4)\)

\(3x - 6 = 5x + 20\)

-Subtract \(5x\) from \(3x\) :

\(3x - 6 -5x = 5x -5x + 20\)

\(-2x - 6 = 20\)

-Add both sides by \(6\) :

\(-2x - 6 + 6 = 20+6\)

\(-2x = 26\)

-Divide both sides by \(2\) :

\(\frac{-2x}{-2} = \frac{26}{-2}\)

\(x = -13\)

So, now you have found the answer.

How many grams of CO2 are in 3.6 mol of CO2?

Answers

Explanation:

The SI base unit for amount of substance is the mole. 1 mole is equal to 1 moles CO2, or 44.0095 grams.

I hope you help:)

There are 158.4 grams of CO2 in 3.6 mol of CO2.

HOW TO CALCULATE MASS?

The mass of a substance can be calculated by multiplying the number of moles of the substance by its molar mass. That is;

mass of CO2 = no. of moles × molar mass

According to this question, there are 3.6 moles of CO2.

mass of CO2 = 3.6 moles × 44g/mol

mass of CO2 = 158.4g.

Therefore, there are 158.4 grams of CO2 in 3.6 mol of CO2

Learn more about mass at: https://brainly.com/question/15959704

the second order decomposition of xy has a rate constant of 7.02 x 10-3 m-1s-1. a.what is the half-life for this reaction at an initial concentration of 0.100 m? b.how long will it take for the concentration of xy to decrease to 12.5% of its initial value when theinitial concentration is 0.100m? c.if the initial concentration of xy is 0.150m, how long will it take to decrease to 0.062 m? d.if the initial concentration of xy is 0.050m, what is the concentration of xy after 500 seconds?

Answers

The respective answers for second order decomposition of xy are

                         a- 1424.5 s.

                         b- 9971.5 s

                         c- 1347.9 s

                         d- 0.042 m

Lets try to solve this equation-

The given rate constant (k) is 7.02 × 10-3 m-1 s-1.

The second order reaction can be represented as

A → products

The integrated rate law for second-order reaction is given as;

1/[A]t = kt + 1/[A]0 where [A]0 is the initial concentration of A.

The half-life of a second-order reaction is given by

t1/2 = 1/k[A]0

The initial concentration of the reaction = [A]0 = 0.100 m

a)

The half-life can be calculated by substituting the given values in the above equation;t1/2 = 1/(7.02 × 10-3 m-1 s-1 × 0.100 m)t1/2 = 1424.5 s

Therefore, the half-life for this reaction at an initial concentration of 0.100 m is 1424.5 s.

b)

We have to determine the time it takes for the concentration of A to decrease to 12.5% of its initial value.

The concentration of A at any time is given by the following equation;

[A]t = [A]0/(1 + kt[A]0)

0.125[A]0 = [A]0/(1 + k × t [A]0)

8 = 1 + k × t[A]0

k × t[A]0 = 7

t = 7/(7.02 × 10-3 m-1 s-1 × 0.100 m)t = 9971.5 s

Therefore, it will take 9971.5 seconds for the concentration of A to decrease to 12.5% of its initial value when the initial concentration is 0.100m.

c)

If the initial concentration of xy is 0.150m, how long will it take to decrease to 0.062 m

The concentration of A at any time is given by the following equation;

[A]t = [A]0/(1 + kt[A]0)

0.062[A]0 = 0.150m/(1 + 7.02 x 10-3 × t0.150m)

= 1347.9 s

Therefore, it will take1347.9 seconds for the concentration of A to decrease from 0.150 m to 0.062 m

d)

The concentration of A at any time is given by the following equation;

[A]t = [A]0/(1 + kt[A]0)[A]t = [0.050 m]/[1 + (7.02 × 10-3 m-1 s-1) × (500 s) × (0.050 m)] = 0.042 m

Therefore, the concentration of xy after 500 seconds is 0.042 m.

Learn more about second order kinetics : https://brainly.com/question/12984106

#SPJ11

A redox reaction can be divided into two ____ -reactions, each of which represents one aspect of electron transfer.

Answers

A redox reaction can be divided into two half reactions, each of which represents one aspect of electron transfer.

A redox reaction can be defined as a chemical reaction in which the  electrons are transferred between two reactants that are  participating in the chemical reaction. This transfer of electrons can be identified by observing the changes in the oxidation states of the reacting species.

By doing so we can differentiate two types of reactions happening here one is called as the oxidation reaction and the other is called as the reduction reaction. These reactions are individually known as the half cell reactions. When we combine these half cell reactions we get a redox reaction.

To know more about redox reactions

https://brainly.com/question/13293425

#SPJ4

What is meant by 5% m/v aqueous sollution of dextose?

Answers

A 5% m/v solution of dextrose is equivalent to a 2.76% w/v solution of dextrose (since 5 g/100 mL is equivalent to 2.76 g/100 mL, or 2.76%).

In a 5% m/v aqueous solution of dextrose, the concentration of dextrose is 5 grams per 100 milliliters of water (g/100 mL).Explanation:Dextrose is a type of sugar that is commonly used in intravenous (IV) solutions to provide energy to the body. The percentage concentration of dextrose in a solution can be expressed in various ways. One common way is as a percentage weight/volume (% w/v) solution, which means the number of grams of solute (dextrose) per 100 milliliters of solution. For example, a 5% w/v solution of dextrose means there are 5 grams of dextrose per 100 mL of solution.Another way to express the concentration of dextrose is as a percentage volume/volume (% v/v) solution, which means the number of milliliters of solute (dextrose) per 100 milliliters of solution. For example, a 5% v/v solution of dextrose means there are 5 mL of dextrose per 100 mL of solution. However, this method of expressing concentration is less common than % w/v.A 5% m/v solution of dextrose means the concentration is expressed as mass (grams) of solute per volume (milliliters) of solution. This is similar to % w/v, but the units of concentration are different. To convert from % m/v to % w/v, the molecular weight of the solute must be known. For dextrose, the molecular weight is 180.16 g/mol. Therefore, a 5% m/v solution of dextrose is equivalent to a 2.76% w/v solution of dextrose (since 5 g/100 mL is equivalent to 2.76 g/100 mL, or 2.76%).

learn more about solution

https://brainly.com/question/16792877

#SPJ11

Which element is a liquid at 1000.K

Answers

Answer:

silver?

Explanation:

The element is Silver

Vocabulary crossword puzzle properties of minerals

Answers

Answer:

? no image

Explanation:

An Assay Question

THE FUNDAMENTAL NATURE OF STRATEGIC MANAGEMENT REQUIRES THE AWARENESS & UNDERSTANDING OF OUTSIDE FORCES & ENCOURAGES STRATEGIC MANAGERS TO ADOPT NEW IDEAS .

ELABORATE in one word ?

Answers

The fundamental nature of strategic management requires the awareness & understanding of outside forces & encourages strategic managers to adopt new ideas is known as Adaptation.

Three definitions of adaptability are connected. First, natural selection, a dynamic evolutionary process, adapts organisms to their environments, improving their evolutionary fitness. Second, it is a state that the populace has attained along that process. Thirdly, it is a phenotypic characteristic or adaptive trait that has been preserved and has evolved via natural selection and has a functional purpose in each individual organism.

History has recorded descriptions of adaptation going back to the time of the ancient Greek philosophers Empedocles and Aristotle. Natural theology of the 18th and 19th centuries saw adaptation as proof of the presence of a deity.

To know more about Adaptation

https://brainly.com/question/31886336

#SPJ11

What caused the water level in the pipe to change when you put the bottle in cold water

Answers

Answer:

Water cooled down and contracted.

Explanation:

When water contracts, its volume decreases. When the volume of the water in the bottle system decreases, the water is pulled farther down the clear pipe.

What molecule is critical for atp production in humans?
select one:
a. carbon dioxide
b. nitrogen
c. oxygen
d. carbon monoxide

Answers

Carbon dioxide molecule is critical for Adenosine Triphosphate (ATP) production in humans.  

During aerobic cellular respiration, glucose reacts with oxygen, forming ATP that can be used by the cell. Carbon dioxide and water are created as byproducts. The overall equation for aerobic cellular respiration is: In cellular respiration, glucose and oxygen react to form ATP. Many processes are capable of producing ATP in the body, depending on the current metabolic conditions. ATP production can occur in the presence of oxygen from cellular respiration, beta-oxidation, ketosis, lipid, and protein catabolism, as well as under anaerobic conditions. ATP is also formed from the process of cellular respiration in the mitochondria of a cell. This can be through aerobic respiration, which requires oxygen, or anaerobic respiration, which does not.

To learn more about Adenosine Triphosphate here

brainly.com/question/859444

#SPJ4

Cell organizations^ pls help

Cell organizations^ pls help

Answers

Cell > tissue > organ > organ system > whole organism

Answer:

Multicellular organisms have cells that are organized in specific ways to perform specialized functions. From the most complex level to the simplest level, the five levels of organization for the sheep should be ordered as:

whole organism → organ system → organ → tissue→ cell

Explanation:

which one of the following equations represents the reaction between dilute hydrochloric acid and calcium hydroxide?

Answers

The equation that represents the reaction between dilute hydrochloric acid and calcium hydroxide is HCl + Ca(OH)2 → CaCl2 + H2O. The equation that represents the reaction between dilute hydrochloric acid and calcium hydroxide is HCl + Ca(OH)2 → CaCl2 + H2O.

In this reaction, hydrochloric acid (HCl) reacts with calcium hydroxide (Ca(OH)2) to form calcium chloride (CaCl2) and water (H2O). This is a double displacement reaction where the positive ions of the reactants switch places to form the products.  

In this reaction, the hydrochloric acid (HCl) reacts with the calcium hydroxide (Ca(OH)2) to produce calcium chloride (CaCl2) and water (H2O). The hydrogen ion (H+) from the hydrochloric acid combines with the hydroxide ion (OH-) from the calcium hydroxide to form water, while the calcium ion (Ca2+) from the calcium hydroxide combines with the chloride ion (Cl-) from the hydrochloric acid to form calcium chloride.

To know more about reaction visit:

https://brainly.com/question/14025220

#SPJ11

The equation representing the reaction between dilute hydrochloric acid and calcium hydroxide is HCl + Ca(OH)2 → CaCl2 + 2H2O.

The reaction between dilute hydrochloric acid and calcium hydroxide can be represented by the following equation:

HCl + Ca(OH)2 → CaCl2 + 2H2O

In this reaction, hydrochloric acid (HCl) reacts with calcium hydroxide (Ca(OH)2) to form calcium chloride (CaCl2) and water (H2O).

The balanced equation shows that 1 molecule of hydrochloric acid reacts with 1 molecule of calcium hydroxide to produce 1 molecule of calcium chloride and 2 molecules of water.

This reaction is an example of a double displacement reaction, where the positive ions of the two reactants exchange places to form new compounds.

To balance the equation, it is necessary to ensure that the number of atoms of each element is the same on both sides of the equation. In this case, there is one calcium (Ca) atom, two chlorine (Cl) atoms, two hydrogen (H) atoms, and two oxygen (O) atoms on each side of the equation.

It is important to note that the coefficients in a balanced chemical equation represent the relative number of molecules or moles involved in the reaction.

Learn more about equation

https://brainly.com/question/29174899

#SPJ11

which element would be most likely to gain electrons in a chemical bond

Answers

Answer:

Elements that are nonmetals tend to gain electrons and become negatively charged ions called anions.

TIME REMAINING
58:01
The mass number of Fe2+ is 56. How many neutrons are there in a single Fe2+ atom?
28
30
56
58

Answers

Answer:

30

Explanation:

A mass number indicates the total number of protons and neutrons. An element is defined by its number of protons, however neutrons can vary (this is what causes isotopes). By definition, iron (Fe) has 26 protons. Since the mass number is the number of protons + the number of neutrons, the number of neutrons is the mass number - the number of protons, in this case 56-26=30

A Fe2+ ion has a positive charge (but its number of protons can't change without it becoming a different element) so since each proton is +1 to charge and each election is -1, to get a +2 charge, there must be 2 more protons than electrons, so a Fe2+ ion has 24 electrons, but this does not affect the mass number or the number of protons.

Answer:

30

Explanation:

edge2023

One role scientists play in hospitals is to
Responses


A research the cause of various diseases.research the cause of various diseases.


B assist doctors during surgeries.assist doctors during surgeries.


C take care of patients after surgeries.take care of patients after surgeries.


D run the activities of the hospital.

Answers

By investigating the origins of various diseases, scientists play a key role in hospitals. They aid in understanding the underlying processes, risk factors, and potential therapies for many illnesses through their scientific knowledge and research techniques.

To understand the intricacies of diseases , their study involves running tests, analysing data, and working with other medical specialists. By figuring out the underlying reasons, scientists make it possible to create efficient diagnostic equipment, therapeutic methods, and preventative techniques .

Their discoveries and techniques expand medical knowledge, improve patient care, and ultimately work towards communities and people experiencing greater health. There are very factors that contribute to the overall institution.

Learn more about diseases at :

https://brainly.com/question/943439

#SPJ1

cathodic protection by zinc sacrificial anodes: impact on marine sediment metallic contamination pdf

Answers

Overall, cathodic protection by zinc sacrificial anodes is an effective method of protecting metal structures in the marine environment from corrosion. While it may result in some increase in zinc and other metal concentrations in marine sediment, the impact is generally minimal and not harmful.

The anodes corrode preferentially to the metal they are protecting, thereby preventing corrosion of the protected metal. However, this process can also result in the release of zinc ions into the surrounding environment, including marine sediment. Cathodic protection by zinc sacrificial anodes is a common method of protecting metal structures in the marine environment from corrosion.

The impact of zinc sacrificial anodes on marine sediment metallic contamination has been studied in several research papers. One such study, titled "Impact of cathodic protection with zinc sacrificial anodes on metallic contamination in marine sediment" by M. Pérez-López et al. (2014), investigated the effects of cathodic protection using zinc anodes on the concentration of metals in marine sediment.

The study found that the use of zinc anodes did result in an increase in zinc concentration in the marine sediment, as well as a slight increase in copper concentration. However, the increase was not significant enough to cause any adverse effects on the marine environment or human health.

You can learn more about cathodic protection at: brainly.com/question/31557529

#SPJ11

What is the maximum number of single covalent bonds a carbon atom can form with other elements?.

Answers

Answer:

Four is the maximum number of single covalent bonds that can be formed by carbon. Carbon has four electrons in the valence shell.

Explanation:

Explain why a liquid can flow whilst a solid retains its shape.

Answers

Probably because the particles that make up a solid are held in their place by the extremely strong forces of attraction
While in a liquid the forces of attraction between the particles are a bit weaker as compared to solids therefore allowing the liquid to flow and take the shape of its container

Answer:

A solid will retain its shape; the particles are not free to move around. Liquid matter is made of more loosely packed particles. It would take the shape of its container. Particles can move about within a liquid,  they are packed densely enough that volume is maintained.

Explanation:

Other Questions
I need the answer asap Anna elizabeth was disappointed to notice that her new phone had several scratches on its screen. if she had known about the clear protective films that were available to protect the phone display from scratches, she could have avoided this problem. for anna elizabeth, the protective films were _____. which of the following statements is a normative as opposed to a positive economic statement? group of answer choices consumer spending generates more jobs. if the price of gasoline goes up, people buy less. labor unions should be allowed to organize in every industry. government intervention in markets is common in many countries. In the film "he named me malala," malala famously says in her speech to the united nations, "one teacher, one child, one book and one pen - they can change the world. " how does malala think an education will make a difference in people's lives? do students think that going to school will help them learn the skills necessary to stand up to injustices? Let f(x)=p(x)/q(x) be a rational function, where p and a are polynomials in standard form with no common factors other than 1. if the degree of p equals the degree of q, which equation represents the horizontal asymptotes of f? Write an explicit formula for each sequence. Find the tenth term. 1,4,9,16, ............ Y=3x4 equals the x by the way after discovering that the shadows outside his window were only the trees in the yard, ralph's blood pressure decreased and his heartbeat slowed. these physical reactions were most directly regulated by hisa.sympathetic nervous system.b.somatic nervous system.c.hippocampus.d.parasympathetic nervous system. what is the difference in potential energy between a proton that is perfectly aligned in an external magnetic field of 1.5 t g The length of the rectangle is 8 inches longer than half its width.the area is 18 square inches.how many inches wide is the rectangle? a.2in b.4in c.8in d.9in how many types of tenses Let A = {x, y, z, t, q} and B ={x y, z, t, p, q, r, s}.Find and show each steps. There are several distinguishing characteristics that make animals different from any other organism. Which of these is not a fundamental characteristic of all animals? Margaret purchased a used pickup truck at a cost of $12,400, with sales tax of $600, to use in her floral business. She purchased the pickup (five-year property) and placed it in service on June 1 of the current tax year. Assuming Margaret opts out of bonus depreciation, using MACRS, what is the first-year cost recovery deduction that Margaret can claim what is the approximate value of this square root? 162 enter your answer, rounded to the nearest tenth, in the box. Complete the following statement. write your answer as a decimal or whole number. % of $40 = $16 In the ACME rubber ball factory, a stream of rubber balls, each of mass m, comes out of a horizontal tube at a rate of R per second. These balls fall a distance of h into a bucket of mass M suspended by a rope from the ceiling. If the balls bounce out of the bucket back to their original height when leaving the tube, what is the (average) tension T in the massless rope holding the bucket What is the wavelength (in nm) of the photon absorbed for a transition of an electron from n_initial=1 that results in the least energetic spectral line in the ultraviolet series of the H atom?be sure your answer has the correct number of significant figures. note: reference the fundamental constants and si prefixes tables for additional infor Which of the following has become a stereotypical emblem of middle adulthood? a) living will b) impotence c) reading glasses d) cane. What is the one requirement for a wave? oa period o a frequency o a medium o a wavelength